ZFIN ID: ZDB-TSCRIPT-090929-11741
Transcript Name: zgc:103482-202
Previous Name: zgc:103482-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029339 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029339|OTTDARG00000022695|ZDB-GENE-041010-115 zgc:103482|OTTDARP00000023960 DKEY-30K6.2-002 LG_ AL844141.7 Danio rerio protein_coding KNOWN, 796 bp
GGTGATCGGTGGCTTCAATCGATGGGCGCTGCTTAAAGTC
TATATTTTCTATTTTTATAGCATTCTTCGATGATAGCGCG
TCGATTATTTCATTTCCCTTGTAACACTGGATAAAAATGA
AGGAGTTGGTGGAAGAGATGCCTGATGAGGGATATGGATG
CACCGTGGCTAATCGTTTTGGTCAGCTTCTGGGCGACGAG
TCCGACCCTTTCGACATCCTATATGCTGCAGGGACTGAAA
AAAAGCAGAAGAAGAAGAAAGAGGAGCCAAAGAAAACTTC
AACCACGACTAAATCTGTAAAGAAAGAGTCTCAGAGGGAC
AGGAAAACCATCCTTCCCGCAGGTGGGGGCGGACAAGTTC
GTCCTGGTCATGAAGTCGTTGAGGAGCCAATACAGAGACG
CGTAACTTTTGACCGCAAATTTAATGATGCCGAAAAGCCT
CCCCTCAGTTTCTCTGTTGAAAGGCCCGTGGATGTGCTGG
ACAGGCCTGCCAGAGGAAGAGGTACTGGAAGAGGAAAAGG
AGCACGAGGCCCAGGATTTCCAAGATCCAATGATGGATTT
GATCAGAGAGGAAAGCGAGAGTTTGAGAGACACAGTGGCA
GTGACCGATCGGGCAGACTTGGTGATTTGGGGGCCCTAAG
CAATTCCAGGAGTGTCCGTTCTGAAGAGAAGCGCAGTGGC
AGCGGATCTCGCAACTGGGGTTCTGTGAGAGACCATATGA
GTGTAATTGAAGTAGCCTCACCTAGTGAAGAGGTCACTGA
AAATGAAGAGACCCAGGAGGCAGTTGAGACTGATGG

zgc:103482 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:103482-201 (1)    Ensembl 1446
zgc:103482-202 796
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:103482-202 Contained in:
[BAC] DKEY-30K6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000029339 (1),  Ensembl_Trans:ENSDART00000146615 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE713722 (1) 878 bp
CITATIONS (2)