ZFIN ID: ZDB-TSCRIPT-090929-11740
Transcript Name: zgc:103482-201
Previous Name: zgc:103482-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029338 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029338|OTTDARG00000022695|ZDB-GENE-041010-115 zgc:103482|OTTDARP00000023959 DKEY-30K6.2-001 LG_ AL844141.7 Danio rerio protein_coding KNOWN, 1446 bp
CTTTTATATGAACCTGAATTCAATTATCTAAACGTCATCC
TTGACGGTTGTTTTGTTTGGTGATCGGTGGCTTCAATCGA
TGGGCGCTGCTTAAAGTCTATATTTTCTATTTTTATAGCA
TTCTTCGATGATAGCGCGTCGATTATTTCATTTCCCTTGT
AACACTGGATAAAAATGAAGGAGTTGGTGGAAGAGATGCC
TGATGAGGGATATGGATGCACCGTGGCTAATCGTTTTGGT
CAGCTTCTGGGCGACGAGTCCGACCCTTTCGACATCCTAT
ATGCTGCAGGGACTGAAAAAAAGCAGAAGAAGAAGAAAGA
GGAGCCAAAGAAAACTTCAACCACGACTAAATCTGTAAAG
AAAGAGTCTCAGAGGGACAGGAAAACCATCCTTCCCGCAG
GTGGGGGCGGACAAGTTCGTCCTGGTCATGAAGTCGTTGA
GGAGCCAATACAGAGACGCGTAACTTTTGACCGCAAATTT
AATGATGCCGAAAAGCCTCCCCTCAGTTTCTCTGTTGAAA
GGCCCGTGGATGTGCTGGACAGGCCTGCCAGAGGAAGAGG
TACTGGAAGAGGAAAAGGAGCACGAGGCCCAGGATTTCCA
AGATCCAATGATGGATTTGATCAGAGAGGAAAGCGAGAGT
TTGAGAGACACAGTGGCAGTGACCGATCGAGTGTCCGTTC
TGAAGAGAAGCGCAGTGGCAGCGGATCTCGCAACTGGGGT
TCTGTGAGAGACCATATGAGTGTAATTGAAGTAGCCTCAC
CTAGTGAAGAGGTCACTGAAAATGAAGAGACCCAGGAGGC
AGTTGAGACTGATGGGGAAAACAGACCATCTGAGACTGAG
GAAGTGATTGAGGTTGCCATGGAGATGACACTGGATGAGT
GGAAAGCGCTGCAAGAGCAAAGCAGGCCCAAAGTAGAGCT
GAATATCCGTAAGACTGAGTCATCTGTGCCATCCAAGGCT
GTGGTGATCCACAAGTCCAAATTACTTCAGAAACAAGATG
GCATGGATGAGGATGTGGTTTTCCGTCGCCCTGCCAATGA
CATCACATGTCAACTGGAATTTAACTTTGGCAGTCTGGAT
CGGCCAACTCGTGGTGGAAGAGGTGGACGAGGTGGTCGTG
GCCGTGGGGGTCCATCCATGCCGACCCTACGATCTCCACA
AAAATTTGATTCTGCTCCAAACCCAGATGATCCGGAAGAT
TTTCCTGCACTGGCTTAATGCCCTTTTGGAGGAAGTGTGT
GATGATCAAACATATGTTAATAATACTGAAATGGGCAATG
TACACGTGAAATGATTAAAAAAAGAAACTATGCACAAAGT
TGGTTCTTTGCATTTTCTGTAACATGCATTGTATATAGTT
TTGAAACTTTTGCACTTGTTTGGAATGAATATTTTTAAGA
GGCTGTAGTGGTTTGTTCTAAAATAAAGCATCCTGTTAAT
GGCACA

zgc:103482 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:103482-201 1446
zgc:103482-202 (1)    Ensembl 796
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:103482-201 Contained in:
[BAC] DKEY-30K6 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000029338 (1),  Ensembl_Trans:ENSDART00000003299 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC083399 (1) 1297 bp
GenBank:EE713456 (1) 858 bp
GenBank:BM101848 (1) 647 bp
CITATIONS (2)