ZFIN ID: ZDB-TSCRIPT-090929-11446
Transcript Name: slc25a48-003
Previous Name: zgc:92090-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029015 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029015|OTTDARG00000022522|ZDB-GENE-040718-60 slc25a48|no_translation DKEY-280E21.2-003 LG_ BX511257.16 Danio rerio protein_coding KNOWN, 921 bp
ACACACATTACACTTGTTCCAAACCTGGTTAAGATTCTTT
CTTCTGTTGAACACAAAAGAATATATTTTGAATAATGTTG
AAAAACAGTAGTCGATGGCCTTCATATAATTTGTTTTTCC
AACCGTGGATGCCAATGGCTACCGAATTTCATGCAGGATT
CTTCAAAATATATTGCTTTGTGAGGAAAAAAAAACTTATA
AAGATTTAGATCAACGTGAGGTCAAGTAAACTGTGAGTTA
ATTTTAATTTTTGGGTGAACTGTCCCTTTAAGGGAAAACC
TCCTACAGTAGGTAATGATTACTAAATGCTAATCATTTCC
AAGAAACTAAACAATTGAAAAAAGTCTACTAAAAATGCAT
AGAGCATTACTCATATACTGTTTTGTGTGGTTTCAGAGAA
CTTCAACCTTGCTGGGAATGGGAGCGTCCCTCTTCGGTCA
ATGGGAATTCAGAGCCAGTCGTTTTACAGAGGGCCTCTAC
ACTGCATTAGTACAGTCCTGCAGAATGAGGGTATTCAAGG
GCTCTACAGAGGAGCCGGAGCTATGATACTGCGGGATATA
CCTGGTTATGCTCTGTACTTCATACCGTACACATTGTTCT
GTAACTGGCTGAATCCTGATGACAATAGCTCACCGCCTCC
ATGCTGCATATGGCTAGCAGGAGGTTTAGCAGGATCAATC
TCATGGGTCACTGCAACACCATCCGATGTGGTGAAAAGCC
GCTTGCAGGCAGATGCTATGCATCAGAGGAAATACAAGGG
CATTTTGCATTGTATCATGCAAAGTTACAGAACAGAGGGA
ATACATGTAAGTTGCTGAAATTATTTAATGCATTTTCAAG
TTTGTATTTCGAGTTTTAGAATGATTTTTTGCAACAGCTT
CCGGGCATGAACAGCTGGCCAAAGACTTAGAAAAATAACA
A

slc25a48 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA slc25a48-003 921
mRNA slc25a48-201 (1) 1551
aberrant processed transcript slc25a48-202 (1) 841
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc25a48-003 Contained in:
OTHER slc25a48-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029015 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CF594657 (1) 966bp
    CITATIONS (1)