ZFIN ID: ZDB-TSCRIPT-090929-11445
Transcript Name: slc25a48-202
Previous Names: slc25a48-002, zgc:92090-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029014 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029014|OTTDARG00000022522|ZDB-GENE-040718-60 slc25a48|OTTDARP00000048977 DKEY-280E21.2-002 LG_ BX511257.16 Danio rerio protein_coding KNOWN, 841 bp
CTCAGCTTTTATAGATCTGACGAACTCTTAAATAAAGCTT
AAGGATGTTTGGCTTGAACTTTTAAATCAATGCATCAATG
CCGACGCCTATGTGGAAATCTCCCGTGTAAATTCACTCAG
TTGTACAATGACAGTCTTTCAGTTGGATGATTTTTTAGCA
GGGTGGATTGGAGGAGCATCCAGTGTGATCGTAGGTCATC
CACTTGACACAGTCAAGACTCGCTTACAAGCTGGCAAAGG
ATACAAGAATACTTTCCACTGTGTTGTCACAATCTACAAA
AAGGAAAATGTAAGGTTTTATAACCTTTTGTGGTTATAGG
CTTTTTCAAAGGACTGTCCTTTCCACTGGCTAGCATCACG
CTTTATAACTCTATGGTATTCGGCTTCTTCAGCAACACAC
AGCGCCTCATTAGCAAATACCGTTATGGTGATGGTAGACA
CCCATGCAGCATGCTGGACTTGACTGTAGCGAGCATGCTG
ACCGGTCTGGTGTCAGTGGGGGTTGGAGCCCCTGTTGACC
TGGTCAAAATTAGACTACAAATGCAAACTCAACCTGTCCT
TGCAGAGAACTTCAACCTTGCTGGGAATGGGAGCGTCCCT
CTTCGGTCAATGGGAATTCAGAGCCAGTCGTTTTACAGAG
GGCCTCTACACTGCATTAGTACAGTCCTGCAGAATGAGGG
TATTCAAGGGCTCTACAGAGGAGCCGGAGCTATGATACTG
CGGGATATACCTGGTTATGCTCTGTACTTCATACCGTACA
CATTGTTCTGTAACTGGCTGAATCCTGATGACAATAGCTC
ACCGCCTCCATGCTGCATATGGCTAGCAGGAGGTTTAGCA
G

slc25a48 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA slc25a48-003 (1) 921
mRNA slc25a48-201 (1) 1551
aberrant processed transcript slc25a48-202 841
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc25a48-202 Contained in:
OTHER slc25a48-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029014 (1)
  • Ensembl_Trans:ENSDART00000131886 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN771694 (1) 882bp
    GenBank:CN324157 (1) 776bp
    CITATIONS (2)