ZFIN ID: ZDB-TSCRIPT-090929-11444
Transcript Name: slc25a48-201
Previous Names: slc25a48-001, zgc:92090-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000029013 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000029013|OTTDARG00000022522|ZDB-GENE-040718-60 slc25a48|OTTDARP00000023725 DKEY-280E21.2-001 LG_ BX511257.16 Danio rerio protein_coding KNOWN, 1551 bp
ACCTCAGCTTTTATAGATCTGACGAACTCTTAAATAAAGC
TTAAGGATGTTTGGCTTGAACTTTTAAATCAATGCATCAA
TGCCGACGCCTATGTGGAAATCTCCCGTGTAAATTCACTC
AGTTGTACAATGACAGTCTTTCAGTTGGATGATTTTTTAG
CAGGGTGGATTGGAGGAGCATCCAGTGTGATCGTAGGTCA
TCCACTTGACACAGTCAAGACTCGCTTACAAGCTGGCAAA
GGATACAAGAATACTTTCCACTGTGTTGTCACAATCTACA
AAAAGGAAAATGTTATAGGCTTTTTCAAAGGACTGTCCTT
TCCACTGGCTAGCATCACGCTTTATAACTCTATGGTATTC
GGCTTCTTCAGCAACACACAGCGCCTCATTAGCAAATACC
GTTATGGTGATGGTAGACACCCATGCAGCATGCTGGACTT
GACTGTAGCGAGCATGCTGACCGGTCTGGTGTCAGTGGGG
GTTGGAGCCCCTGTTGACCTGGTCAAAATTAGACTACAAA
TGCAAACTCAACCTGTCCTTGCAGAGAACTTCAACCTTGC
TGGGAATGGGAGCGTCCCTCTTCGGTCAATGGGAATTCAG
AGCCAGTCGTTTTACAGAGGGCCTCTACACTGCATTAGTA
CAGTCCTGCAGAATGAGGGTATTCAAGGGCTCTACAGAGG
AGCCGGAGCTATGATACTGCGGGATATACCTGGTTATGCT
CTGTACTTCATACCGTACACATTGTTCTGTAACTGGCTGA
ATCCTGATGACAATAGCTCACCGCCTCCATGCTGCATATG
GCTAGCAGGAGGTTTAGCAGGATCAATCTCATGGGTCACT
GCAACACCATCCGATGTGGTGAAAAGCCGCTTGCAGGCAG
ATGCTATGCATCAGAGGAAATACAAGGGCATTTTGCATTG
TATCATGCAAAGTTACAGAACAGAGGGAATACATGTTTTC
TTTCGTGGAGCGACTGTAAATGCTATCAGAGGATTTCCGA
TGTGTGCAACTATGTTTCTTGGTTACGAGCTTTCCCTCCA
GTTTTTCCGCAGTTTTTAACACAAACTCGTGCTGAAAATA
TGCTAATGCACATTATAAGCTCTTAGAAATTATAATAGAG
CATCGATGGTTTAATAACAAGTAGAAACTTACATGTGACA
TTTATGTGAGTTCATTGTTGATACAGTGAAGAGTATCAGT
GAAGCTTTTAGGTGTTTCTTATATTAAGAAATTGTTTAAA
ATAGGTATGTATTTTCAATATATATATATAAAAGATATTT
TAATATATGATTATGCATCATCTGCATGTGAATGATATAC
TAATTTTTTATTTTACTCAAAAAAGACCTTTCTTATTTTG
TCAGCATATGTATTCTGCATTTAAACATGGTCACTATTAT
GCATTATTTGTTTACAAATTATTGCTTAAATGCATTTTTA
TGTAATTTTTCCACTATAGGCTTTTAATGCAGCAGGCATT
TAAAATGATTATCTGCTAATGCATTGTGAAGTAAACATGT
GAATAAATCAAGTGGTATAGTGGCCCTGTAA

slc25a48 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA slc25a48-003 (1) 921
mRNA slc25a48-201 1551
aberrant processed transcript slc25a48-202 (1) 841
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc25a48-201 Contained in:
OTHER slc25a48-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000029013 (1)
  • Ensembl_Trans:ENSDART00000040955 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC075888 (1) 1555bp
    GenBank:DN833906 (1) 925bp
    GenBank:DR715987 (1) 740bp
    CITATIONS (2)