header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11278
Transcript Name: zgc:111976-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028836 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028836|OTTDARG00000022406|ZDB-GENE-050522-332 zgc:111976|no_translation DKEY-192L18.3-002 LG_ BX005461.9 Danio rerio protein_coding KNOWN, 732 bp
GACGAGTGGAGGATGTGAGGGTTGCTCATCACGGGGAAGC
TCCTGTAGTGAGAGATCTACAGATTACCTTTTCAGAACGC
ACTGTATAACCTAGAGATGTGGCGGTGTTCATGTGTTACC
TGTATAAACACTGTTTGTTTTGTTTTAGTCCAGCCCGTCA
CTCCTGCAGCTGTTAAGGATGAAACAATTTGAAGAGTTCT
CCCTAAAGTTGGATGATCTTGCCTCATTTTACAACATCCC
AGGAGACAGATCTCTGAGAGAAAGTGACCTTCACATTGAC
CTCATTATGAACGGCAGGATTGGGAACGTGCAGTCTGGCA
GAGAGGGCTCACCAATGACCATCGAGTACTACATAAGTCC
AGCAGATGCTCTCATGGGGCTGTCAAGCACCGGAGAGGTC
AGCGCTGGCCGTGTAGCTCTGGTGACGGCGGGCAGCACTG
ACTCCTCTCACAGACTGCAGATGGAGTCTCTGATCTCCTC
TCCTCCTCAGGTCGACTCTTGCGGGTTTCCTGTGTTTCAG
CCACTCACTGAGGCCTGTTCGCTGCTTCTCCCTGCAACCT
TTCTGCTCAAACTACAGCCGCCGTTACCTGTGCTCACGTC
CTTCATAGAGAAGATGGGCAAAATCACAGATGGTGTTATA
GCAGAGAAACCCCTGCAGGTGGAGCCGCTGCACAAACTAC
TCCTGAAGACCAGCAGAAAATACAACCCCAACACATCGTG
CACAGACGGCCT

zgc:111976 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA zgc:111976-002 732
mRNA zgc:111976-201 (1) 1975
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:111976-002 Contained in:
OTHER zgc:111976-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028836 (1)
  • Ensembl_Trans:ENSDART00000143838 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN507056 (1) 732bp
    CITATIONS (2)