header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11277
Transcript Name: zgc:111976-201
Previous Name: zgc:111976-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028835 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028835|OTTDARG00000022406|ZDB-GENE-050522-332 zgc:111976|OTTDARP00000023583 DKEY-192L18.3-001 LG_ BX005461.9 Danio rerio protein_coding KNOWN, 1975 bp
CTCCCGCCTCCAGATTCTCGAGCGCGCCCGCTAATTAGAG
TCAATTAGAAGATAATTAGCCTCAGAAAAGTAGATATAAG
TTTGAATATTCATTTTCATTTGGTTATCTCGAAGTGATGA
GTTCTTAATCTTCTGACATAAGTCTAGAACAGCAGTCTGA
ACGTATTTAAGAAAACAAAATGGAGTTCAAGAGCGAGCGC
GGTCCTGTATGCATGAAGACCAAAACTTTAATGTCTGAAT
TAAAGTCCAAATATGCTGAGAAATCTTGGAATGAGTCATT
CCAGCTGGTACGGAGATGTATGGAAAAAACACGAGACGGC
AGAGTTTGTGAACCAATCGCAAAATGTCTGCAGAAGATCA
ACGAGGCGCTCAACGTGTCGTCCTCCGCAGCAATGGTGTC
CAGACTAGAGATGATCGCCAAACAAAGAGGCTTGGGGTCC
CACCTGAGCCCCACAGAGACGGTGTGTTACCTGACCGCAG
ACCTGTTTTATATCGAGGTGCTGCTGCTGCCGGGAGGACG
AGTGGAGGATGTGAGGGTTGCTCATCACGGGGAAGCTCCT
GTATCCAGCCCGTCACTCCTGCAGCTGTTAAGGATGAAAC
AATTTGAAGAGTTCTCCCTAAAGTTGGATGATCTTGCCTC
ATTTTACAACATCCCAGGAGACAGTGATGTGAAGATTAAA
GTCTACAGCTCTCTTCGGCACCTGGAAACTGACCTCTTCA
AAATATCCCATTTGCCAAGATCTCTGAGAGAAAGTGACCT
TCACATTGACCTCATTATGAACGGCAGGATTGGGAACGTG
CAGTCTGGCAGAGAGGGCTCACCAATGACCATCGAGTACT
ACATAAGTCCAGCAGATGCTCTCATGGGGCTGTCAAGCAC
CGGAGAGGTCAGCGCTGGCCGTGTAGCTCTGGTGACGGCG
GGCAGCACTGACTCCTCTCACAGACTGCAGATGGAGTCTC
TGATCTCCTCTCCTCCTCAGGTCGACTCTTGCGGGTTTCC
TGTGTTTCAGCCACTCACTGAGGCCTGTTCGCTGCTTCTC
CCTGCAACCTTTCTGCTCAAACTACAGCCGCCGTTACCTG
TGCTCACGTCCTTCATAGAGAAGATGGGCAAAATCACAGA
TGGTGTTATAGCAGAGAAACCCCTGCAGGTGGAGCCGCTG
CACAAACTACTCCTGAAGACCAGCAGAAAATACAACCCCA
ACACATCGTGCACAGACGGCCTGCAGTTTCTTGTGCCGCT
GCCTGGCTCTGAGTGCCACAGTTATGTGTTCCCCGGGGCC
CAATGGAGCTGCGAGAACTGGAACGGAGCCCTGATGGATG
CGGTGCCGTTCTCGCACCCGGGCCACGTCCCAGCTTTACT
GGAGATCCTCCGCCATCAGTCTGCCATCAGCGTCCTGCTG
GAGAGCTGCTTCAGCAAACACAGCCACAGCAGGGATGCAG
CTTTACTGTCTGAGCTGACATGTGAGCTGCTTCCAGAATC
AGACCACTGCTTTTCCATCACATTCAGCCTCCATGAGAGC
GAGCATCTGGCTGTTCTTCATGTGGCGGTGGTGGACTCTC
ATCAGATGAGCTGCAAACTCCTCATGCCTGATTTTATGGA
TCACGAGCTGGATGAGTACATATCCAGAGTCCTCATGCGA
TGCATGTCCATCCCCATCACAATGAGGGCTGTATGCAGGA
GAGTGGCCAGTCTGCGGACGCGTCCCGCACCAGTGTCAGA
CCCAGATGAGAGTGAGTGTGTCCCCGCTGCGGTTCAGGAG
GACATCAGCGTTTCTCTTACTCCTGATTTCTGTGATAAAG
CCAATACAGACGCGTTTGTTAACCCTTCCCCATGTGCCTC
TCTGGGTGTCTATTCACACTGGGCCACCGCTGGACTTCCA
GCAGAACTCGTGTAATCTCCTGCTTTTACTGTAGAGTTCA
CTTCATATCAGGGTTTTAGACTGAGGTTAAATAAAGGTAT
GTTATTTTAAAAGCA

zgc:111976 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA zgc:111976-002 (1) 732
mRNA zgc:111976-201 1975
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:111976-201 Contained in:
OTHER zgc:111976-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028835 (1)
  • Ensembl_Trans:ENSDART00000082526 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC095630 (1) 1751bp
    GenBank:BM316577 (1) 518bp
    GenBank:EB922914 (1) 231bp
    CITATIONS (2)