ZFIN ID: ZDB-TSCRIPT-090929-11039
Transcript Name: pon2-201
Previous Names: pon2-001, zgc:77556-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028553 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028553|OTTDARG00000022227|ZDB-GENE-030131-7116 pon2|OTTDARP00000023344 DKEY-56F14.1-001 LG_ CR848666.4 Danio rerio protein_coding KNOWN, 1169 bp
GGACATGGCAACACTGATGGTGTTTGTGCGCTGGACTTTC
AGACAGTTATGGGCACGTTAGCTTTTCTCTCGCTTGCGGT
TGTCGCTTTTGCAGTTTTGATAGGAGAAAGACTCATTTCA
TTAAGGCATGTAGCGCTTTCCTACAGAGAACTAACCCAGA
ACTATCTTCCTAACTGCAATTTTATAGAGGGCATAGATTT
TGGGGCTGAAGATATCACCATACTTGATGGATTGGCCTTT
CTTAGTACTGGCTTGAAGTATCCTGGTGTACCATCCTACT
CAGAAGACCCAGGAAAGATCTACACACTGAACCTGTTGGA
CTCTGAACAAAAAATTAAAGTACTACACATCAGGGGAGAC
TTTGACAAAGACTCCTTTAATCCACATGGAATCAGTGTGT
ACACAGATGATAAAGATGGTGCAATATACCTGTTTGTTGT
TAATCATCCTCAAGGCAAAAGTCAAGTGGAGATTTTCAGA
TTTTTGGAGAATGAAAATGCTCTTGAATACTTAAAGACCA
TTAGGCATGAGCTCCTGCACAACGTGAATGATATAGTGGC
TGTGGGGACTGAAAGCTTTTATGCCACCAATGATCATTAC
TTCACCAATGACATTCTGAAGATTGTGGAGCCATTTCTCT
CTTTGCCGTGGTGTGATGTGGTTTATTACAGTCCTGAGAC
TGTGCAAGTTGTGGCAGGAGGATTCTTATCTGCCAACGGC
ATAAACATCTCCCCTGACAAAAGACACTTGTATGTATCAC
ATATTCTGAAGCACACAATTGCTGTCTTGGAAATACAGAA
AAACACTGTATTGTCTCATGTAAAGGAAATTGATGTGGGG
TCTCTCTGTGACAACATTGAGGTGGATCGTGAGACTGGAG
ATCTGTGGATTGGCTGTCACCCAAACGGTCTCAAATGTGT
TTTTCATGATCCAAATGATCCACCTGGTTCTGAGGTAATC
AGGATTGAGAACATCCTCTCTGAAAAGCCCCAGGTGACTC
AGGTGTATTCAGATGACGGCAGTGTTATCATTGCTTCTTC
GGTGGCAGCTCCTTATAGAGAAAAACTGCTCATTGGAACA
GTTTATCAGAAAGCTCTCATCTGTGACCTTAAATAGTGAT
ATTATGCACTTACATAGGAGAATAAATATTGTCTAAGTTT
TTGAAAGAA

pon2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA pon2-002 (1) 853
mRNA pon2-201 1169
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pon2-201 Contained in:
OTHER pon2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028553 (1)
  • Ensembl_Trans:ENSDART00000008326 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC067171 (1) 1220bp
    GenBank:BQ617775 (1) 590bp
    CITATIONS (2)