ZFIN ID: ZDB-TSCRIPT-090929-11040
Transcript Name: pon2-002
Previous Name: zgc:77556-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028554 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028554|OTTDARG00000022227|ZDB-GENE-030131-7116 pon2|no_translation DKEY-56F14.1-002 LG_ CR848666.4 Danio rerio protein_coding KNOWN, 853 bp
TTAGCTTTTCTCTCGCTTGCGGTTGTCGCTTTTGCAGTTT
TGATAGGAGAAAGACTCATTTCATTAAGGCATGTAGCGCT
TTCCTACAGAGAACTAACCCAGAACTATCTTCCTAACTGC
AATTTTATAGAGGGCATAGATTTTGGGGCTGAAGATATCA
CCATACTTGATGGATTGGCCTTTCTTAGTACTGTATGTAA
ATTAATTAATCTGTAATTTATTGGGCCACTGATGATGTCT
CCATAAAAGTACTTATTTGATTTAATATCAATTTTGCTAA
AAGCACATTGTTAAATTGCCAAACTGTACAAGTGTAGATT
TTACTGTTGACGGAAAATGAATTCTGCATAGGGCTTGAAG
TATCCTGGTGTACCATCCTACTCAGAAGACCCAGGAAAGA
TCTACACACTGAACCTGTTGGACTCTGAACAAAAAATTAA
AGTACTACACATCAGGGGAGACTTTGACAAAGACTCCTTT
AATCCACATGGAATCAGTGTGTACACAGATGATAAAGATG
GTGCAATATACCTGTTTGTTGTTAATCATCCTCAAGGCAA
AAGTCAAGTGGAGATTTTCAGATTTTTGGAGAATGAAAAT
GCTCTTGAATACTTAAAGACCATTAGGCATGAGCTCCTGC
ACAACGTGAATGATATAGTGGCTGTGGGGACTGAAAGCTT
TTATGCCACCAATGATCATTACTTCACCAATGACATTCTG
AAGATTGTGGAGCCATTTCTCTCTTTGCCGTGGTGTGATG
TGGTTTATTACAGTCCTGAGACTGTGCAAGTTGTGGCAGG
AGGATTCTTATCTGCCAACGGCATAAACATCTCCCCTGAC
AAAAGGCAGGTTG

pon2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA pon2-002 853
mRNA pon2-201 (1) 1169
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pon2-002 Contained in:
OTHER pon2-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028554 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK026403 (1) 828bp
    CITATIONS (1)