header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11022
Transcript Name: rps19-202
Previous Name: rps19-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028535 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028535|OTTDARG00000022213|ZDB-GENE-040426-1716 rps19|OTTDARP00000023329 CH211-213B7.1-002 LG_ CR391920.11 Danio rerio protein_coding KNOWN, 861 bp
TCTTCCTTTTGCTGTCCACAAGCAAGATGCCAGGTGGTGT
AACAGTGAAAGACGTCAACCAGCAGGAGTTTGTCCGGGCG
CTGGCAGCCTTCCTCAAAAAGTCGGGGAAGCTGAAGGTGC
CAGATTGGGTTGACATTGTCAAACTTGCTAAGCATAAGGA
GTTGGCTCCCTGTGATGAGAACTGGTTCTACATCAGAGCT
GCCTCCACAGTGCGTCACCTGTACCTGCGTGGAGGTGTTG
GCGTGGGCTCTATGACCAAGATCTATGGCGGGCGTAAGAG
GAACGGTGTGTGCCCCTCTCACTTCAGCGTGGGCTCCAAA
AATGTTGCCCGTAAAGTACTCCAAGCCCTTGAGGGCCTCA
AGATGGTGGAGAAAGACCCCAATGGCGGGCGTAGACTGAC
CCCCCAGGGGACCAGAGACCTGGACAGAATTGCTGGGCAG
GTGGGTGCCGTTGCATTACTGTATTTGAGAACTTGAGCTC
TTACAACGTTGATTTTCTAAAGTCATATTTAAGAAGCTAT
TGATTTTGTTGGTTAGGGTTCTTAACTTAAACAGATACTG
TATGAGCGATTGTGGGATCTCATAATTTACAAAATAGTGT
TTCCTTTAGTTTTATAATTAAATTTTAATAAAATTCAAAT
GAGGCTGTATAATGCAGCTTTGAAGAGCAGATGCAGGTAC
TAAGTGTGAGGAATCGACTGACTTAAAAGGCCTTGCGGTT
CAGTTTTGACTGCAGTAGCTTTGATTTAGTGTGTGGACAC
AGTACAGTCTTTAAAAAGGAAATGCATGCACATCATCTCC
AAAGCCTTCGCTTGCATTTCACCCCCTCTGTTGGTCCTCT
GCTTTCCCTGTGAGCTACCGC

rps19 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rps19-201 (1) 631
rps19-202 861
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rps19-202 Contained in:
OTHER rps19-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028535 (1)
  • Ensembl_Trans:ENSDART00000136205 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE318307 (1) 850bp
    GenBank:EB764003 (1) 599bp
    CITATIONS (2)