ZFIN ID: ZDB-TSCRIPT-090929-11022
Transcript Name: rps19-202
Previous Name: rps19-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028535 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028535|OTTDARG00000022213|ZDB-GENE-040426-1716 rps19|OTTDARP00000023329 CH211-213B7.1-002 LG_ CR391920.11 Danio rerio protein_coding KNOWN, 861 bp
TCTTCCTTTTGCTGTCCACAAGCAAGATGCCAGGTGGTGT
AACAGTGAAAGACGTCAACCAGCAGGAGTTTGTCCGGGCG
CTGGCAGCCTTCCTCAAAAAGTCGGGGAAGCTGAAGGTGC
CAGATTGGGTTGACATTGTCAAACTTGCTAAGCATAAGGA
GTTGGCTCCCTGTGATGAGAACTGGTTCTACATCAGAGCT
GCCTCCACAGTGCGTCACCTGTACCTGCGTGGAGGTGTTG
GCGTGGGCTCTATGACCAAGATCTATGGCGGGCGTAAGAG
GAACGGTGTGTGCCCCTCTCACTTCAGCGTGGGCTCCAAA
AATGTTGCCCGTAAAGTACTCCAAGCCCTTGAGGGCCTCA
AGATGGTGGAGAAAGACCCCAATGGCGGGCGTAGACTGAC
CCCCCAGGGGACCAGAGACCTGGACAGAATTGCTGGGCAG
GTGGGTGCCGTTGCATTACTGTATTTGAGAACTTGAGCTC
TTACAACGTTGATTTTCTAAAGTCATATTTAAGAAGCTAT
TGATTTTGTTGGTTAGGGTTCTTAACTTAAACAGATACTG
TATGAGCGATTGTGGGATCTCATAATTTACAAAATAGTGT
TTCCTTTAGTTTTATAATTAAATTTTAATAAAATTCAAAT
GAGGCTGTATAATGCAGCTTTGAAGAGCAGATGCAGGTAC
TAAGTGTGAGGAATCGACTGACTTAAAAGGCCTTGCGGTT
CAGTTTTGACTGCAGTAGCTTTGATTTAGTGTGTGGACAC
AGTACAGTCTTTAAAAAGGAAATGCATGCACATCATCTCC
AAAGCCTTCGCTTGCATTTCACCCCCTCTGTTGGTCCTCT
GCTTTCCCTGTGAGCTACCGC

rps19 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA rps19-201 (1)    Ensembl 631
rps19-202 861
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rps19-202 Contained in:
[BAC] CH211-213B7 (1)

Genome Resources: Vega_Trans:OTTDART00000028535 (1),  Ensembl_Trans:ENSDART00000136205 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE318307 (1) 850 nt
GenBank:EB764003 (1) 599 nt
CITATIONS (2)