header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-11021
Transcript Name: rps19-201
Previous Name: rps19-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028534 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028534|OTTDARG00000022213|ZDB-GENE-040426-1716 rps19|OTTDARP00000023328 CH211-213B7.1-001 LG_ CR391920.11 Danio rerio protein_coding KNOWN, 631 bp
CTCCAGTGTTCAAGTCTCGCGATAAGAACCGTGACTCGCC
CCTGTTAACACGCTTAGGAAACCCTGCGCGTGCCTCTTCC
TTTTGCTGTCCACAAGCAAGATGCCAGGTGGTGTAACAGT
GAAAGACGTCAACCAGCAGGAGTTTGTCCGGGCGCTGGCA
GCCTTCCTCAAAAAGTCGGGGAAGCTGAAGGTGCCAGATT
GGGTTGACATTGTCAAACTTGCTAAGCATAAGGAGTTGGC
TCCCTGTGATGAGAACTGGTTCTACATCAGAGCTGCCTCC
ACAGTGCGTCACCTGTACCTGCGTGGAGGTGTTGGCGTGG
GCTCTATGACCAAGATCTATGGCGGGCGTAAGAGGAACGG
TGTGTGCCCCTCTCACTTCAGCGTGGGCTCCAAAAATGTT
GCCCGTAAAGTACTCCAAGCCCTTGAGGGCCTCAAGATGG
TGGAGAAAGACCCCAATGGCGGGCGTAGACTGACCCCCCA
GGGGACCAGAGACCTGGACAGAATTGCTGGGCAGGTTGCT
GCTGCAAGCAAGAAAGTGTAAAATAAACTTTTGTTGGAAA
CCAGTTTCTGTGTCTTAGTCTTCTGTCTTTGATTTTTTTT
CCCCCTCAGCATTAAAAATAAAATGCTGTAA

rps19 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rps19-201 631
rps19-202 (1) 861
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rps19-201 Contained in:
OTHER rps19-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028534 (1)
  • Ensembl_Trans:ENSDART00000048599 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK361508 (1) 596bp
    GenBank:EG565600 (1) 587bp
    GenBank:BC059557 (1) 492bp
    CITATIONS (2)