Transcript

slc5a1-002

ID
ZDB-TSCRIPT-090929-10875
Name
slc5a1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028379 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028379|OTTDARG00000022109|ZDB-GENE-040426-1524 slc5a1|no_translation DKEY-106L3.2-002 LG_ BX324123.4 Danio rerio protein_coding KNOWN, 941 bp
TTTATTTCCTTCGTTGAACACAAAAGAAACTATTCTGAAT
TCGAAGAATGTTGGAAGCCAGTAGCTATATGAATACTAAT
ACTATGGAAATCAATAACTGCCGGTTTTCAACATTTTTCT
AAATATCTTATTTTGCGGTCAACGGAAAGAAGAAACTCAA
AGGCTTGGAACAATTTGAGCATTGGAGCCTCTCTCTTCGC
AAGTAACATCGGAAGTGGTCATTTTGTGGGAATTGCAGGA
ACTGGAGCTGCTGCTGGAATCGCCATCGGAGGATTTGAGT
GGAACGCTCTGGTTGTTGTGATTATTCTGGGATGGCTCTT
TGTGCCCATCTACATAAAGGCTGGGGTTGTGACTATGCCA
GAGTACCTAAAGAAGAGGTTTGGTGGTCAGCGAATCCGCA
TCTACCTCTCTGTGCTGTCACTGTGCCTCTACGTTTTCAC
CAAAATTTCGGCGGACATGTTTGCAGGAGCCATTTTCATC
AACCAGGCTCTAGGACTGAACATTTACCTGGCTGTGGTAA
TTCTGCTGCTGATTACAGCTCTTTACACAGTAACAGGTGG
TTTAGCTGCTGTCATCTACACAGACACACTGCAGACCATC
ATCATGGTGGTGGGATCGTTCATCCTCATGGGCTTTGCAT
TTAATAAGGTTGGAGGCTATGAGAACTTTAGGGACAGCTA
TATGACTGCCATCCCGTCAGTAATCGGTACAAACATCAGT
GAATCTTGCTACACCCCTCGTGCAGACTCATTCCACATTT
TCAGAGATCCCATTAATGGAGATCTGCCCTGGCCAGGACT
CCTCTTTGGTCTTACAATCCAGGCCGGCTGGTACTGGTGC
ACGGACCAGGTGATTGTTCAGCGTTGTCTGTCTGCGAAGA
ACCTCTCTCATGTGAAGGCTGGCTGTATTTTGTGTGGTTA
CCTCAAGCTGCTGCCCATGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations