Transcript

slc5a1-202

ID
ZDB-TSCRIPT-090929-10874
Name
slc5a1-202
Previous Names
  • slc5a1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028378 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028378|OTTDARG00000022109|ZDB-GENE-040426-1524 slc5a1|OTTDARP00000023199 DKEY-106L3.2-001 LG_ BX324123.4 Danio rerio protein_coding KNOWN, 2655 bp
TAAGTGAGCACACACTCGCACATGCATGCACAGTGTCTTG
AGCATCGAGGGACGCACTTGCCCTCCTCAAACACCGTCAG
AATGGGTGCAGATTATTTTGGATTTTCACTGCTCCGCAAT
GATGTCAAAAGAAACACCACCATATATGTGAACAACCCAG
CTGACATTTCTGTGATTGTCATTTATTTTCTGGTGGTTCT
GGCGGTGGGAGTATGGGCCATGGTACGGACCAATCGAGCC
ACGGTCGGTGGCTTTTTCCTGGCCGGCAGAAGTATGGTGT
GGTGGCCGATTGGAGCCTCTCTCTTCGCAAGTAACATCGG
AAGTGGTCATTTTGTGGGAATTGCAGGAACTGGAGCTGCT
GCTGGAATCGCCATCGGAGGATTTGAGTGGAACGCTCTGG
TTGTTGTGATTATTCTGGGATGGCTCTTTGTGCCCATCTA
CATAAAGGCTGGGGTTGTGACTATGCCAGAGTACCTAAAG
AAGAGGTTTGGTGGTCAGCGAATCCGCATCTACCTCTCTG
TGCTGTCACTGTGCCTCTACGTTTTCACCAAAATTTCGGC
GGACATGTTTGCAGGAGCCATTTTCATCAACCAGGCTCTA
GGACTGAACATTTACCTGGCTGTGGTAATTCTGCTGCTGA
TTACAGCTCTTTACACAGTAACAGGTGGTTTAGCTGCTGT
CATCTACACAGACACACTGCAGACCATCATCATGGTGGTG
GGATCGTTCATCCTCATGGGCTTTGCATTTAATAAGGTTG
GAGGCTATGAGAACTTTAGGGACAGCTATATGACTGCCAT
CCCGTCAGTAATCGGTACAAACATCAGTGAATCTTGCTAC
ACCCCTCGTGCAGACTCATTCCACATTTTCAGAGATCCCA
TTAATGGAGATCTGCCCTGGCCAGGACTCCTCTTTGGTCT
TACAATCCAGGCCGGCTGGTACTGGTGCACGGACCAGGTG
ATTGTTCAGCGTTGTCTGTCTGCGAAGAACCTCTCTCATG
TGAAGGCTGGCTGTATTTTGTGTGGTTACCTCAAGCTGCT
GCCCATGTTCCTCATGGTCTTCCCTGGCATGATCAGCAGA
GTGCTGTACCCAGATGAAATTGCCTGTGTGGATCCGGATG
AGTGTAAAGCTGTCTGTGGAGCCGAAGTGGGCTGCACTAA
CATCGCTTATCCCAAACTTGTGGTGGACCTGATGCCAAAT
GGTCTCCGAGGGCTGATGTTGTCCGTCATGTTGGCTTCAC
TCATGAGTTCACTCACCTCCATCTTCAACAGCGCCAGCAC
ACTCTTCACCATGGACATTTACACCAAGATCAGGCCCAAA
GCCAAGGAAAAGGAGCTGATGATTGCCGGCAGGTTGTTTA
TGCTGCTGTTGATCGGCATCAGTATCGCATGGATCCCCAT
CGTTCAGACAGCTCAGAGTGGTCAGCTCTTCGACTACATT
CAGTCCATCACCAGTTATCTGGCTCCACCAATCGCTGCTG
TCTTTGCACTTGCTATTTTCTGCAAGCGAGTCAATGAACC
TGGTGCTTTCTATGGGTTGTGTGTTGGTCTGCTGGTGGGT
CTGGCGCGTATGATAACAGAGTTTGCCTACGGCACAGGCA
GCTGCGTGAATCCCAGTAACTGTCCCACGATCATCTGCGG
TGTCCACTACCTCTACTTCGCCCTCATCCTCTTCGGCCTG
TCCTGCATATTGATCCTGTCCATCTCACTTATGACCAAAC
CAATTGAAGACAAACATCTCTACAGGCTGTGCTGGAGTTT
GAGGAACAACACAGAGGAGAGGATTGACCTGGAGGCAGAC
GACTGGACTGAGGACCAGGACTCCAACTCTATGGAAACAG
ATGAGATGCGTGAGGAGCCAGGCTGTTGTAAGAAGGCCTA
CAACTGGTTCTGCGGCTTCGATCAAGGCAATGCTCCCAAA
CTGACTAAAGAACAGGAGGCTGAGCTGAAGATGAAGCTCA
CCGACACCACTGAGAAACCTCTATGGAGAAATGTGGTCAA
CGCTAACGCCGTTATCCTCCTCACCGTCTGCGTCTTTTTC
CACGGTTTCTTCGGTTAAACATCACTGGACAGAAATGTTA
CTTTGTCAGTAACATCAAGCGAAATTGTGATTCATCTGAT
TGTAAGAGGCTACAAAGTTCATCTTGAAGAACTCAGTACT
TCCTTTTCCTCAACAGAAACTCTTCCCTTCCGTATAGATT
AATTAATATATACAGTTTTGGCTCCTTTCTCTCTGTTTTC
ATTTGTAAGCCTGGACCAGAACTGATACATATAATCATGT
TTTGTTTTTTGTTTTTTTGTTGTTTTTTACAGGAGCTGAT
AATTTAACATGTTCTTGATGGTTTTACTGTAAATTCAGTA
TTGTTTACAGTCCAAAGCTGCACATTCTTTTTCATTTTAC
ACAGCAATAGTTTCAACTTACATTATGAAGTTCTGGTCTT
CTAATGTATTATGATCAATTCAATGCAAAGCTTTTTCAAC
TGTCTCACATCTACTAAATTACTGTTAGATAAGTTGGAGC
TTAAATATATATATATTTGTTTAAGACAAGGGTATTTTAT
TTAATAATATTCATATTTTTGGCATGTTATATACGTGCTC
TCTGTAATATATTAATGTGGCTGTCTTTATTGTAATAAAG
AGAAATTAATTGTCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations