header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10821
Transcript Name: uxt-202
Previous Names: uxt-002, zgc:101894-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028323 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028323|OTTDARG00000022073|ZDB-GENE-040912-118 uxt|OTTDARP00000028050 CH211-257I15.1-002 LG_ CR356245.25 Danio rerio protein_coding KNOWN, 996 bp
GACAGACCGAAGGAAGGTTTAGCTTCATTTAACGTACTCG
ATACTTCATATATTTGCTACTACAATATATTAATCTGTCA
TATGTAAGCTTTAATCGCTGCATCAGCCCAGCGACGTGCT
GTTAATGTTTGATGCACATTAATATTAGAAACATCGATTG
CTATTAAATAAAACTTCGATCTGTTATCATCTCATATCAT
GACTTCTGGCACATCTGTTATTAATGACAAAGTCTTGCAG
TATGAGACATTCATCAGTGAAGTATTAAGACGAGACCTGC
AGAAAGTGGTGGAGCAAAAGAGATGCTGTGGATGAGAAAA
TACGGCAATACCTGCAGCTGAAGAACACAATATAATAAAA
TATAGTTCAAGAACACTATAGTATTTACCATAAATTACTA
TAGTATTTTTTCATTTGAGTACTCTCTGCTCTGCCAGGAA
AGTGCTGGAGCAAAGAGATGCTGTGTATGAGAAAATCGCA
CAATACCTGCAGCTGAAGAACACAATACAAAGCATTCAGG
AAAGCGGCAGCAAAGAACTGAAAACCGATGTTGACCTTGG
CTGCAATTTCTATGTGCAGGCTCATGTACCTGATGCATCA
AGAATATATGTGGCAGTCGGATATGGATTCTTTGTCGAAT
TCACGCACGCAGAGGCTTTGAAGTTCATTGAAAAGAAGAC
AAATCAGCTCACAGAGTATACTGAAGTTCTTACCAAAGAT
GCAGCAAAGATAAAAGCCAACATTCGCATGGTTCTGGAGG
GGTTGAGGGAATTGCAAGGACTGAAGGATCTTCCAGAGGA
CAGAAGGAGAGAGGTGTTTTAGTACCATACACCAATCACA
GCACAGTGTATTCATCTTTGCACATATGACTGCAATGTTT
GTTTCAAACAATGTGAACATTATGGCAATCATGTTCAGAA
GAACGTTGCCTTTTAACAGGTTGTACTGTTGTTTCCAGAA
ATAGCTGCTGAATAAAGTGTAAAATTTTTCAGTTAA

uxt TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript uxt-202 996
mRNA uxt-201 (1)    Ensembl 860
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
uxt-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000028323 (1),  Ensembl_Trans:ENSDART00000137780 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CT716306 (1) 871 bp
GenBank:CT716307 (1) 764 bp
CITATIONS (2)