header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10820
Transcript Name: uxt-201
Previous Names: uxt-001, zgc:101894-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028322 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028322|OTTDARG00000022073|ZDB-GENE-040912-118 uxt|OTTDARP00000023158 CH211-257I15.1-001 LG_ CR356245.25 Danio rerio protein_coding KNOWN, 860 bp
AAACAAGTGTGGAGCCACGTGACAGACCGAAGGAAGGTTT
AGCTTCATTTAACGTACTCGATACTTCATATATTTGCTAC
TACAATATATTAATCTGTCATATGTAAGCTTTAATCGCTG
CATCAGCCCAGCGACGTGCTGTTAATGTTTGATGCACATT
AATATTAGAAACATCGATTGCTATTAAATAAAACTTCGAT
CTGTTATCATCTCATATCATGACTTCTGGCACATCTGTTA
TTAATGACAAAGTCTTGCAGTATGAGACATTCATCAGTGA
AGTATTAAGACGAGACCTGCAGAAAGTGCTGGAGCAAAGA
GATGCTGTGTATGAGAAAATCGCACAATACCTGCAGCTGA
AGAACACAATACAAAGCATTCAGGAAAGCGGCAGCAAAGA
ACTGAAAACCGATGTTGACCTTGGCTGCAATTTCTATGTG
CAGGCTCATGTACCTGATGCATCAAGAATATATGTGGCAG
TCGGATATGGATTCTTTGTCGAATTCACGCACGCAGAGGC
TTTGAAGTTCATTGAAAAGAAGACAAATCAGCTCACAGAG
TATACTGAAGTTCTTACCAAAGATGCAGCAAAGATAAAAG
CCAACATTCGCATGGTTCTGGAGGGGTTGAGGGAATTGCA
AGGACTGAAGGATCTTCCAGAGGACAGAAGGAGAGAGGTG
TTTTAGTACCATACACCAATCACAGCACAGTGTATTCATC
TTTGCACATATGACTGCAATGTTTGTTTCAAACAATGTGA
ACATTATGGCAATCATGTTCAGAAGAACGTTGCCTTTTAA
CAGGTTGTACTGTTGTTTCCAGAAATAGCTGCTGAATAAA
GTGTAAAATTTTTCAGTTAA

uxt TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript uxt-202 (1)    Ensembl 996
mRNA uxt-201 860
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
uxt-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000028322 (1),  Ensembl_Trans:ENSDART00000021209 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC081425 (1) 875 bp
GenBank:CT721412 (1) 404 bp
CITATIONS (2)