ZFIN ID: ZDB-TSCRIPT-090929-10698
Transcript Name: akr1a1b-007
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028184 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028184|OTTDARG00000021982|ZDB-GENE-050417-118 akr1a1b|no_translation CH211-175H18.2-007 LG_ CR854855.7 Danio rerio protein_coding KNOWN, 877 bp
ACGAGGCGATACCCCTTTTCCAAGAAAGGAAGACGGAACC
TTGCTGTATGACGACATAGACTATAAACTGACATGGGCTG
CAATGGAAAAACTTGTGGGAAAGGGTCTTGTCAGAGCAAT
TGGACTCTCAAACTTCAACAGTAGGCAAATCGATGACATC
TTATCAGTTGCAAGCATCAAACCCACAGTTTTACAGGTGG
AGTCCCATCCATACCTTGCACAGGTTGAGCTGTTGTCTCA
CTGCCGGGATCGAGGTCTGGTAATGACCGCCTACAGTCCC
CTAGGATCTCCTGACCGAGCCTGGAAGCATCCAGACGAGC
CTGTGCTATTGGAGGAACCAGCCATTGCTGCGCTAGCCAA
GAAATACAACAAGACCCCTGCACAAATTATCATCAGGTAA
GTGTGTGCTTTTGCATTGGGTTTTTTTCCACTGATTATTT
TGTCACATTGTTTCTTCATTGATGTTTGGCAGGTGGCAAA
CTCAACGAGGAGTAGTGACTATCCCAAAGAGCATTACACA
GTCTCGGATTAAAGAGAATATCCAGGTTTCTGCAAGCTTC
CCCTTAGTGTTGTATTATGTGGAGGGTTTATAATCACATA
TCATAACAATGCAATGCATTTACCTACAGGTGTTTGATTT
TACTCTTGAATCTGAAGAAATGAGTCAGGTGACAGCTTTA
CACAGAGGCTGGCGTTACATTGTGCCAACTATTACTGTTG
ATGGTAAATCTGTACCCCGTGATGCAGGACATCCTCACTA
CCCGTTTAATGATTCCTATTAATTCACACTTCCACAAGAT
TCTGTGCCTTGGAACCAGCATTCATTAACTTCTCTGTGTA
CTTATAAACACATTAAACATTTTGTTATATACTGAAA

akr1a1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA akr1a1b-201 (1)    Ensembl 754
akr1a1b-202 (1)    Ensembl 1091
akr1a1b-203 (1)    Ensembl 910
akr1a1b-204 (1)    Ensembl 760
akr1a1b-205 (1)    Ensembl 1182
akr1a1b-207 (1)    Ensembl 803
ncRNA akr1a1b-007 877
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
akr1a1b-007 Contained in:
[BAC] CH211-175H18 (1)

Genome Resources: Vega_Trans:OTTDART00000028184 (1),  Ensembl_Trans:ENSDART00000147494 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT681783 (1) 716 nt
GenBank:EB956506 (1) 569 nt
CITATIONS (2)