ZFIN ID: ZDB-TSCRIPT-090929-10698
Transcript Name: akr1a1b-007
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028184 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028184|OTTDARG00000021982|ZDB-GENE-050417-118 akr1a1b|no_translation CH211-175H18.2-007 LG_ CR854855.7 Danio rerio protein_coding KNOWN, 877 bp
ACGAGGCGATACCCCTTTTCCAAGAAAGGAAGACGGAACC
TTGCTGTATGACGACATAGACTATAAACTGACATGGGCTG
CAATGGAAAAACTTGTGGGAAAGGGTCTTGTCAGAGCAAT
TGGACTCTCAAACTTCAACAGTAGGCAAATCGATGACATC
TTATCAGTTGCAAGCATCAAACCCACAGTTTTACAGGTGG
AGTCCCATCCATACCTTGCACAGGTTGAGCTGTTGTCTCA
CTGCCGGGATCGAGGTCTGGTAATGACCGCCTACAGTCCC
CTAGGATCTCCTGACCGAGCCTGGAAGCATCCAGACGAGC
CTGTGCTATTGGAGGAACCAGCCATTGCTGCGCTAGCCAA
GAAATACAACAAGACCCCTGCACAAATTATCATCAGGTAA
GTGTGTGCTTTTGCATTGGGTTTTTTTCCACTGATTATTT
TGTCACATTGTTTCTTCATTGATGTTTGGCAGGTGGCAAA
CTCAACGAGGAGTAGTGACTATCCCAAAGAGCATTACACA
GTCTCGGATTAAAGAGAATATCCAGGTTTCTGCAAGCTTC
CCCTTAGTGTTGTATTATGTGGAGGGTTTATAATCACATA
TCATAACAATGCAATGCATTTACCTACAGGTGTTTGATTT
TACTCTTGAATCTGAAGAAATGAGTCAGGTGACAGCTTTA
CACAGAGGCTGGCGTTACATTGTGCCAACTATTACTGTTG
ATGGTAAATCTGTACCCCGTGATGCAGGACATCCTCACTA
CCCGTTTAATGATTCCTATTAATTCACACTTCCACAAGAT
TCTGTGCCTTGGAACCAGCATTCATTAACTTCTCTGTGTA
CTTATAAACACATTAAACATTTTGTTATATACTGAAA

akr1a1b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA akr1a1b-007 877
mRNA akr1a1b-201 (1) 754
akr1a1b-202 (1) 1091
akr1a1b-203 (1) 910
akr1a1b-204 (1) 760
akr1a1b-205 (1) 1182
akr1a1b-207 (1) 803
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
akr1a1b-007 Contained in:
OTHER akr1a1b-007 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028184 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT681783 (1) 716bp
    GenBank:EB956506 (1) 569bp
    CITATIONS (1)