ZFIN ID: ZDB-TSCRIPT-090929-10694
Transcript Name: akr1a1b-202
Previous Name: akr1a1b-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028180 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028180|OTTDARG00000021982|ZDB-GENE-050417-118 akr1a1b|OTTDARP00000023049 CH211-175H18.2-003 LG_ CR854855.7 Danio rerio protein_coding KNOWN, 1091 bp
GAAAAAAACAAATAATTTTTAATCAACCAGGTTTGTCGAG
AAGAATTTTCCTTATCCTACTCACTCAAAGTAAGTATCTG
AACAAATACTATATAAACTGTCCTCCGCACAATAATAAAA
AAAAACAACCATTGTTATGAAGCGCCACATGGGACGCTAG
TTGACCTGATTTCTCAAAGAAATGCAGCATATTCAGCGTG
CTCTCCGTCTCTTCATTCATTCTCACAAGTTTTACTGTCG
AAGAATGGCACACAAGATGAGCATGAATGATTTTGCTGTC
CTGAGCACAGGACGAAAGATGCCCCTTCTGGGACTTGGGA
CATGGAAGAGTGAACCTGGACTAGTAAAGCAGGCAGTTAT
TTGGGCATTGGAATCTGGCTATCGACACATTGATTGTGCT
CCTATTTATGCAAACGAGCCAGAGATTGGTGAAGCTTTCC
AGGAAACGATGGGACCTGATAAAGGCATAAGGCGAGAGGA
TGTGTTTGTGACCTCCAAACTGTGGAACACAAAGCACCAC
CCGGATGACGTAGAGCCGTCTCTATTAAAAACTCTGAAAG
ACCTGAAGCTGGAGTACTTGGACCTCTACCTCATCCACTG
GCCATATGCCTTTCAACGAGGCGATACCCCTTTTCCAAGA
AAGGAAGACGGAACCTTGCTGTATGACGACATAGACTATA
AACTGACATGGGCTGCAATGGAAAAACTTGTGGGAAAGGG
TCTTGTCAGAGCAATTGGACTCTCAAACTTCAACAGTAGG
CAAATCGATGACATCTTATCAGTTGCAAGCATCAAACCCA
CAGTTTTACAGGTGGAGTCCCATCCATACCTTGCACAGGT
TGAGCTGTTGTCTCACTGCCGGGATCGAGGTCTGGTAATG
ACCGCCTACAGTCCCCTAGGATCTCCTGACCGAGCCTGGA
AGCATCCAGACGAGCCTGTGCTATTGGAGGAACCAGCCAT
TGCTGCGCTAGCCAAGAAATACAACAAGACCCCTGCACAA
ATTATCATCAGGTGGCAAACTCAACGAGGAGTAGTGACTA
TCCCAAAGAGCATTACACAGTCTCGGATTAAAGAGAATAT
CCAGGTTTCTG

akr1a1b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA akr1a1b-007 (1) 877
mRNA akr1a1b-201 (1) 754
akr1a1b-202 1091
akr1a1b-203 (1) 910
akr1a1b-204 (1) 760
akr1a1b-205 (1) 1182
akr1a1b-207 (1) 803
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
akr1a1b-202 Contained in:
OTHER akr1a1b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000028180 (1)
  • Ensembl_Trans:ENSDART00000137268 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE694950 (1) 927bp
    GenBank:EE304550 (1) 918bp
    GenBank:EE319381 (1) 903bp
    CITATIONS (2)