ZFIN ID: ZDB-TSCRIPT-090929-10657
Transcript Name: dtd1-002
Previous Name: hars2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028130 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028130|OTTDARG00000021954|ZDB-GENE-040801-175 dtd1|no_translation CH211-85N16.2-002 LG_ AL929341.4 Danio rerio protein_coding KNOWN, 916 bp
ACCGGAAGATTGAGGTGTTCGAGTGTTACACGTGATTGAT
TGGAGACCAAAACAATGAAGGCGATCATTCAAAGAGTAAC
AAGAGCGAGCGTAACAGTTGGAGAGGAGCAGATCAGCTCC
ATCGGCAGAGGACTCTGTGTTTTACTCGGCATCTCAGTGG
AGGACACTCAGAAGGATGTGGACTACATGGTTCGCAAGAT
TCTGAACTTGCGTGTTTTTGAGGATGAGAACGGCCGTGCC
TGGAGCCGCAGTGTGATGGACGGGGAGCTGGAGGTGCTGT
GTGTGAGTCAGTTCACTCTGCAGTGTCTCCTCAAGGGAAA
CAAACCTGACTATCACGCTGCCATGCCTGCTGAACTGGCA
CAACCCTTCTACAACAACATGCTGGAGCAGCTTAGAGAAA
CCTACAAACCAGAACTCATTAAAGACGGGCAGTTTGGAGC
AAAAATGCAGGTGCTGATTCAAAACGACGGACCTGTGACC
ATTCAGCTGGAGTCTCCTCCTGCCCCTACAGACCCCAAAC
TGGTATCCAGCATTTATTTGACTATATCGATGCCTTTCCA
TCATCTTCGAGAGCATTATGAAATTTCTTGATTGTTCTTA
ATACAGCATAAATTGTTTTGGGACATAGAACAGTTTGGCT
GTTGTTCTTTCTTCATTTCTCAGCTGTCCAAACAAGAGAA
GCAACAGCAGAGGAAAGAGAAAACACGGTCAAAAGGGCCG
TCCGACTCAAGCAGAGAGAAGGCAGCGCAACGGTCAAAAG
TAGATCCCAGCGCCAGCAGCGGAGCCGAGGGAGACGTGTC
TTCTGAACGAGAACCATAGACAAACTCACGGATGGGTTCA
GCTTTTAGAGGACTGCTGGTTTCTTTCTGTCCCCCTCAAA
TGTCCATATTAATGCCCATTCTTATCTTCTTCTGAA

dtd1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dtd1-201 (1)    Ensembl 1331
ncRNA dtd1-002 916
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dtd1-002 Contained in:
[BAC] CH211-85N16 (1)

Genome Resources: Vega_Trans:OTTDART00000028130 (1),  Ensembl_Trans:ENSDART00000138283 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN512002 (1) 945 nt
GenBank:CO935377 (1) 831 nt
CITATIONS (2)