ZFIN ID: ZDB-TSCRIPT-090929-10656
Transcript Name: dtd1-201
Previous Names: dtd1-001, hars2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000028129 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000028129|OTTDARG00000021954|ZDB-GENE-040801-175 dtd1|OTTDARP00000023012 CH211-85N16.2-001 LG_ AL929341.4 Danio rerio protein_coding KNOWN, 1331 bp
ATATCTATGTATTGAGTGAAGCCCGTAGCCACTGCTCTGA
GTCACTTTTTAAAAACTGCTAAAAGTAGCCAAATGAATGT
TAAAAAATTGCTAAATTTGTTGCTAGGTGCTTATTTTAAC
AGTTGCTAGGGTAGTTTGAAAAGTTGCTAAATCTAGCAAC
AAAATTGCTAAGTTGGCAACACTGAAGCCTCGTGCATTTA
AAGTTGCTTGTTGTGCTTTAATAGTTGAAAAAAAATCAGA
AATATGTTTAAAGTGGTAAAATCCTGAAAAAAATGCTTTT
ACCAGACCGTATAAACATTATTCACTCCTTCTTTGCGCTT
GTCCACTCCACAAGAGGCACACGCGTCATTGCGCACGCAC
GTTCAAAGAGGCGGGGCTTCACAGAAACCGGAAGATTGAG
GTGTTCGAGTGTTACACGTGATTGATTGGAGACCAAAACA
ATGAAGGCGATCATTCAAAGAGTAACAAGAGCGAGCGTAA
CAGTTGGAGAGGAGCAGATCAGCTCCATCGGCAGAGGACT
CTGTGTTTTACTCGGCATCTCAGTGGAGGACACTCAGAAG
GATGTGGACTACATGGTTCGCAAGATTCTGAACTTGCGTG
TTTTTGAGGATGAGAACGGCCGTGCCTGGAGCCGCAGTGT
GATGGACGGGGAGCTGGAGGTGCTGTGTGTGAGTCAGTTC
ACTCTGCAGTGTCTCCTCAAGGGAAACAAACCTGACTATC
ACGCTGCCATGCCTGCTGAACTGGCACAACCCTTCTACAA
CAACATGCTGGAGCAGCTTAGAGAAACCTACAAACCAGAA
CTCATTAAAGACGGGCAGTTTGGAGCAAAAATGCAGGTGC
TGATTCAAAACGACGGACCTGTGACCATTCAGCTGGAGTC
TCCTCCTGCCCCTACAGACCCCAAACTGCTGTCCAAACAA
GAGAAGCAACAGCAGAGGAAAGAGAAAACACGGTCAAAAG
GGCCGTCCGACTCAAGCAGAGAGAAGGCAGCGCAACGGTC
AAAAGTAGATCCCAGCGCCAGCAGCGGAGCCGAGGGAGAC
GTGTCTTCTGAACGAGAACCATAGACAAACTCACGGATGG
GTTCAGCTTTTAGAGGACTGCTGGTTTCTTTCTGTCCCCC
TCAAATGTCCATATTAATGCCCATTCTTATCTTCTTCTGA
AGCTTGGATTGTATATAAACTCAAGAACAAGTGGCAGCTC
CACAAACACCCGTGGACAAAAGACTCAGGCACATCTGAAT
GTTTACAATGACATCTTATTTATTAAATGTATACATCTCT
GTGATGTGTTTTAATAAAAATTAAGAAAAAAAAAACAATT
GGAAAAAAAAA

dtd1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA dtd1-201 1331
ncRNA dtd1-002 (1)    Ensembl 916
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dtd1-201 Contained in:
[BAC] CH211-85N16 (1)

Genome Resources: Vega_Trans:OTTDART00000028129 (1),  Ensembl_Trans:ENSDART00000065566 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC076141 (1) 930 nt
GenBank:CO915575 (1) 891 nt
GenBank:DN833102 (1) 775 nt
GenBank:BQ783704 (1) 380 nt
CITATIONS (2)