Transcript

zgc:100832-201

ID
ZDB-TSCRIPT-090929-10560
Name
zgc:100832-201
Previous Names
  • zgc:100832-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028027 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028027|OTTDARG00000021891|ZDB-GENE-040801-53 zgc:100832|OTTDARP00000022936 RP71-1K13.2-002 LG_ AL732515.15 Danio rerio protein_coding KNOWN, 722 bp
AAAAAAAAAAAAAAAAAACACAAGCAAAAAGTACACAATG
CTCAGCGAGTGACTCATGTTGTTGTGCACAGATAACCTGT
AAACCTGTTCAAAAACTGATATTTTCCTGTTCCCAGTGTG
GTGACTTCGAAGTGATCTTTAAAGGGAAAAATGGGTCAGG
CTGAGAGCAGAAACACAGCTGCTCCTTTGACGGATTTAAG
GTCCTTGGAGACCAGATTGGCCGCATTCTCAGGTGTGATG
CCAGATGTTCCTCTAACTGTGGTCGAGGAGATCTTGCTGA
ATCTGCCTGCTCATCATGTGGTTAACGAATGTCGTCTGGT
GTGTCCTGAGTGGAAAGAGCTGGTGGACAGTGCTGCACAC
TGGAGAGAGCGCTGTATGAGAGAGGGGATTCAGCCCTGTG
ATGGCTCCAGACCACCAGTGGACTGGTGTCAGTTTTATTT
TATAACTAAGAAACGACGTAACCTGATCAAGAATCCAGTA
GCTGATGATAAATTTCAAGGATGGGAGATTGTCGAGAATG
GAGGTGACCTCTGGAGCATCGAAAACAGTAGGACACCGTT
ACCAGACAAGACAGCCACCAAATGTTTTGTAACATCTTAT
AGGTTGTGTTTGAAGCAACAGCTGATTGATTTGCAGAAAG
AAGGCTACAGTGCTGCTTTCATGGATCATCTGCAACCTCA
CATCAAAATCTCAGACTGGTATGGACCACGTTATGATTGT
GG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations