Transcript

zgc:100832-202

ID
ZDB-TSCRIPT-090929-10559
Name
zgc:100832-202
Previous Names
  • zgc:100832-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000028026 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000028026|OTTDARG00000021891|ZDB-GENE-040801-53 zgc:100832|OTTDARP00000022935 RP71-1K13.2-001 LG_ AL732515.15 Danio rerio protein_coding KNOWN, 1960 bp
AAGCAAAAAGTACACAATGCTCAGCGAGTGACTCATGTTG
TTGTGCACAGATAACCTGTAAACCTGTTCAAAAACTGATA
TTTTCCTGTTCCCAGTGTGTTCTCAGGTGTGATGCCAGAT
GTTCCTCTAACTGTGGTCGAGGAGATCTTGCTGAATCTGC
CTGCTCATCATGTGGTTAACGAATGTCGTCTGGTGTGTCC
TGAGTGGAAAGAGCTGGTGGACAGTGCTGCACACTGGAGA
GAGCGCTGTATGAGAGAGGGGATTCAGCCCTGTGATGGCT
CCAGACCACCAGTGGACTGGTGTCAGTTTTATTTTATAAC
TAAGAAACGACGTAACCTGATCAAGAATCCAGTAGCTGAT
GATAAATTTCAAGGATGGGAGATTGTCGAGAATGGAGGTG
ACCTCTGGAGCATCGAAAACAGTAGGACACCGTTACCAGA
CAAGACAGCCACCAAATGTTTTGTAACATCTTATAGGTTG
TGTTTGAAGCAACAGCTGATTGATTTGCAGAAAGAAGGCT
ACAGTGCTGCTTTCATGGATCATCTGCAACCTCACATCAA
AATCTCAGACTGGTATGGACCACGTTATGATTGTGGATGT
GAGTATCAGATCTGTGTGGAGTTGCTTGGTCAGAATAAGA
ACCCCATCAGTGTCTTTCAGCCTGAGAAAGTGTTCATTCA
AGCGTGGACTGATAAGCCGTGGTATCAAATGATTCATGTC
TTTAAGAATTACGGACCTGGTGTTCGGTTTATCCGCTTCA
CTCATGGAGGGAAGGACACTCAGTTCTGGGCAGGCTGCTA
TGGAATAAGAGTTACTAACAGTAGTGTGGAGATCTGCCCA
GCTGCAGAGAGATAGTCATTTCCTGTATGATTTTTTTAAT
ACTTTATTCTGTCATTCTAACGATGCATGTTTCTATAGCA
CACAAAACATTTTAAATGTAAATATTAGCATTTCTATGAG
TTAAGTCATAGACATACTGTAACGCCACGCCAGCCCTGAC
TACTGACTCAGCTCTGCTCCCTCTGCAGTCACTTCCTGTT
TGTGTAGTATTTCAGTGAGAGCTCAGGCCATGCTTCAGTG
CGAAGTATTGCCAGTTCAAACTGCCTTACCAAGCGTTTCC
AAGAGACTTTCATGACTGCCTGCCTGTGTATGACTGCCTG
CCTGCCTTAATCAAGTACGTTCTCTGTCTTTGCCCTCTTG
CTCTGTTTTGGACTGTTTATTGTTGCCTTGAACTTTTGCC
TACCTTCTCACCACGTCTTCTGGATTTGCCCCTGTGTTTG
TTGATCTGTTTTGGACTGATTGTTGATATACTGAACCCAG
GGCCGGAGCAAGCTGAACTGCCGCTCTAGGCAAAGGACGA
TCACGCCGCCCTCAACCCCAATGTGAAAACGAAAGTGACC
GGTTATGAAAATGAAGTGAGGTGTCGCGGACCTCTATTCT
GCCGCCCTATGCGCGGATATAACTGAGGACGCGCGGGTGC
TGAGGGAGGGAGGGAGGTGTCGCCGACACTGCTCTCTCTA
TTCTGCCGCCCTATGCGCAAAATAACTGAGGACGCGCGGG
TGTCGCGGATCTCTAATCTGCCGCCCTACACGTGGATTTA
ACTGAGGACACACATGGGTGCTGATGGAGTTGTCGCTGAC
TGTGCCCTCTCTATTGTGTCGCCTATGCGCGAATATATCT
GAGGACGCGGGTGGTGAGGGAGGTGTTGCGGACATAACTG
AGGACGCGGGTGGTAAAAGGGGGTGTTGCGGACGCCTCTT
TCTCTATACTGCCGCCCTAGGCGGCCACCTAGGTCGCCTC
TATGGACGCGCCGGCCCTGACTGAACTTCTGCCTGCACTC
TGGATTTGCCCCTGTTTGTTGACTGGATTGGACTGCTTAT
ATTTTGCCTACTTTCTGCCTGTTTACTCACTGATGTCTAT
GCATAAACCCTTTAATAAAACTTCTGGAATATGGATTCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations