header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10397
Transcript Name: ddx42-201
Previous Name: ddx42-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027856 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027856|OTTDARG00000021786|ZDB-GENE-050706-53 ddx42|OTTDARP00000022801 DKEY-15N1.10-001 LG_ BX324157.4 Danio rerio protein_coding KNOWN, 3693 bp
ATGACGTAAAACACAGTCGCCGAGAAGTGTGCAAGATAGC
CCGAAGTGGTAAATACGCTGTGGATAAATAAGGTGTCCAC
CCACTTTAGAAGACCGCTGTTTTCACCTTATCAGTGACAG
CCCAACAACGATGAACTGGAACAAGGGAGGCCCAAGTGGC
AAGCGAGGGTTTGGATTTGGAGGATTCGCTCTTGCGACTG
GGAAGAAAGAGGAGCCTCATCTCCCACAGAAGGCCCACTC
CTCTTTTGGGGGCACGGGACCGTCAGGTGGATATGGCAAG
AATCAGCAGCTATCGTCGTTTTACAAAATAGGAACAAAAC
GAGCCAATTTCGACGAGGAGAACGCTTACTTTGAGGATGA
TGAAGAGGAGTCCACTGCTGACCTGCCGTATATACCCGCT
GAGAACTCTCCCACTAGGAAGCAGTTCCAGTCTGGAGGGG
GAGGAGGAGGTGGGGGCTCGGACAGTGAGGATGACCCTCT
TGATGCCTTTATGGCTGAAGTGGAGGACCAGGCAGCAAAG
GATATGAAAAAACTTGAGGAAAAGGAAAAAGAGAAAAAGA
TGGCCAAGGGTATTCGGGATGACATTGAAGAGGAAGATGA
CCAAGAAGCATATTTTCGCTACATGGCGGAGAACCCAACA
GCTGGGCTGACCCAAGAGGAGGAGGAGGAAGAAGTGGACT
ATGATAGTGATGGAAACCCTATTGCCCCTACTACAAAAAA
GATTATCATGCCCCTGCCCCCCATAGACCACTCAGAGATT
GACTATTCTCCATTTGAGAAGAACTTCTATAATGAGCATG
AGGAAATCAGCAGTTTGACTGGGGCCGAAGTGGTGGAACT
GAGACGGAAACTCAACTTAAAGGTTTCAGGCGCAGCCCCT
CCTAAACCAGCAACCAGTTTTGCCCACTTTGGATTTGATG
AACAGCTCATGCATCAGATTCGTAAATCTGAGTACACTCA
ACCGACCCCCATCCAGTGCCAGGGCGTTCCTATAGCTTTG
AGTGGCAGAGATGCGATTGGCATTGCCAAAACCGGTAGTG
GAAAGACGGCAGCTTTCATTTGGCCAATTCTGGTGCACAT
TATGGACCAGAAGGAGCTGGAGCCGGGAGAAGGGCCCATT
GCTGTGATCGTCTGCCCCACTAGAGAGCTCTGTCAACAGA
TTCATGCTGAATGCAAGCGCTTCGGGAAAGCATACGGCCT
CCGCTCAGTGGCAGTATATGGAGGTGGCAGCATGTGGGAA
CAAGCCAAAGCCCTACAGGAAGGAGCTGAAATTGTTGTCT
GCACCCCAGGCCGTCTGATCGATCATGTAAAAAAGAAAGC
TACGTCTCTGCAGCGAGTGACCTTTCTAGTATTTGATGAA
GCTGATCGCATGTTTGATATGGGCTTTGAATACCAAGTGA
GATCCATTGCCAGCCATGTTCGACCTGATCGACAAACTCT
GTTATTCAGTGCAACTTTCCGGAAGAAAATCGAAAAACTA
GCACGAGATATTTTGGTCGACCCCATTCGTGTGGTGCAGG
GAGACATAGGAGAGGCTAATGAAGACATCACTCAGATAGT
GGAGGTGCTGCAGTCTGGCCAGGACAAATGGGGTTGGCTG
ACCCGCAGACTGGTGGAGTTCACATCCGCTGGCTCAGTGC
TGGTGTTTGTTACTAAAAAGGCTAACTGTGAGGAGCTGGC
AACAAATTTAATTCAGGAAGGATATAGCCTGGGTCTGCTT
CATGGAGACATGGATCAGAGTGAGAGGAACAAAGTCATAG
CAGACTTTAAAAAGAAGAATCTGCCTGTATTGGTGGCGAC
CGATGTTGCTGCTCGTGGGTTGGATATTCCATCTATTCGC
ACTGTTGTCAACTATGATGTAGCCCGGGACATTGACACAC
ATACACATCGAATTGGTAGAACAGGTCGTGCTGGAGAAAA
AGGTGTAGCTTATACATTGCTCACCACTAAAGACACTTCA
TTTGCCGGTGACCTGGTTCGTAATTTAGAGGGAGCCAATC
AGAGTGTTTCAAAAGATCTGTTAGACCTGGCTATGCAGAA
TCCCTGGTTCAGGAAATCTCGCTTTAAGGGAGGAAAAGGG
AAGAAGATTAATATTGGAGGTGGAGGCTTGGGCTATAGAG
AGAGACCTGGCCTTGGATCGGAATGCTCTGAGCGCAGTGG
TGGTTCTATTGCAGCAGCTCTTGGCAACTATGAAACCTTC
AAACCCTCCACTGGAGCAATGGGAGACCGTATGTCTGCCT
TAAAGCAAGCATTTCAGGCTCAGTACAAAAACCACTTTGT
CGCGGCATCAGGTGTGCCTCCTAAACTCACCACAAAGTCC
AGCAGCTCATCTGGATGGACCAGCGCTGGAAGTCTGAGTT
CTTTGCCAACAGGAGCACCTGAGGGGCCGGACAGACCTCA
CCTGTCCTTCTCGCCATCATCCTCTTCCTCGTTTTCCATG
CCACCGCCTCCAGCTCTCACCTCAGGCATTAAAATGAGTG
GCTTCAGCAGTGCGGGCACCCTCAGCTCAATTTCAGACTC
TTACTCTAGCTCTTCTTCAAAAGAGCCGTCCCGTAGCGAG
AGGCACTCTGATGACAGGGGCCGGCATGGAGATAGTCATA
GTCACCGTCATAGTGACAGGCATAGTGGAGGAGAGCGAGA
ACGAGAGAGAGAGCGTGATCGTGACCGCGATCGCCACGGG
GAAAGGGACCGCCATAGTGACAGAGATCGGCATGGGGATA
GCCGAAATGGTGAAGGGAGCCATAGGGACAGAGAGGGACG
GTCAGAAAGAGATGAAGGTGAGAAGTCAGGGTCTCACAAA
GAAAGCTTTGCAGTTCCTGATCCTCCGAAACGTAAGAAAA
GCAGATGGGACAATTGAAGTGTACCAGAAAGTAGCAGTCA
AATGTTCTTAGATCAGAAGGGGCTTTACTTGTCTGCTTTT
TTCTGTATGTTAGATGAAGCTGTATAAAGCGTGACTAGGA
GACTCATCACTTTATCATCTTTATAACTTAATGAACCCAT
TGAAGAAAGGTGTTTTCAACCATTTTAGAATTGTGAATTG
GCAGAATGAGTAACAAAAGGCATATTGAGGCCAAGAGTTG
TTAAATTAGATGTTCCTGTTCTATGGCAAACAGGTTTTGT
TTTGTTTTTCTTTCTAAAATGTTTTTGAAATCTCTGTTTT
AATGTTTTTTTTTATTATGTTGTGCTGCTTTACAAGCTTA
TTGTGAACTATATCATTTTGTTAAGACTTCTGTAGTGTTT
TAATGTGTGCTGTCCTGTCTCAAACACCACCATTTTCAAT
GCCCATGAATGAGCTTGTCTTTTGTTCATGTGTTAATATT
TTGAATTCAGATCTTTTTTTTTTTTTAGCAAACACTTCAG
ATTCTTGTCTTTCTGCGCTCATACATCAACATATAATATG
GTTCTAAAGAAAGAAACCAACTCTACAGTTAATTCTCACA
CACACACACACACACATTCTGACCAAACTAACAACATGAT
TGGGAGTGTAACAAAACCATCATTGAGCCTACAATAAAGA
CTGTGCTGTGATATATTCTTGGATTCCTTTGGTCCTGAGG
TGAATATTGGAGATAGCTGTTATGAAGCTTTGTTACAAAC
TGAATCTGATGACCATTATGAATATGGATATTCTAGTGTA
CAGTTCTGTCTGTGGCCATGCTTCTGAAATAATAAACAAA
TGGTTTAGAGGTT

ddx42 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ddx42-002 (1) 577
mRNA ddx42-201 3693
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ddx42-201 Contained in:
OTHER ddx42-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027856 (1)
  • Ensembl_Trans:ENSDART00000127297 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC079483 (1) 1320bp
    GenBank:CT596470 (1) 845bp
    GenBank:EG574898 (1) 790bp
    GenBank:DT071216 (1) 775bp
    GenBank:CT688655 (1) 768bp
    GenBank:EB974811 (1) 645bp
    GenBank:CT697023 (1) 606bp
    GenBank:EB776669 (1) 319bp
    CITATIONS (2)