header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-558
Transcript Name: ddx42-002
Previous Name: dkey-15n1.10-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053505 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053505|OTTDARG00000021786|ZDB-GENE-050706-53 ddx42|no_translation DKEY-15N1.10-002 LG_ BX324157.4 Danio rerio protein_coding KNOWN, 577 bp
GGAGTCCACTGCTGACCTGCCGTATATACCCGCTGAGAAC
TCTCCCACTAGGAAGCAGTTCCAGTCTGGAGGGGGAGGAG
GAGGTGGGGGCTCGGACAGTGAGGATGACCCTCTTGATGC
CTTTATGGCTGAAGTGGAGGACCAGGCAGCAAAGGATATG
AAAAAACTTGAGGAAAAGGAAAAAGAGAAAAAGATGGCCA
AGTAAGAGTCTGTCATGATTACATTAAAAAAAAGAAAATC
AACACTGTTCATCCTGATAATATTTTAACAGAGGATGGGA
ATAGATGGGGTTTATGGGTAGAGTATGGGTTTCCATGGGT
GATTGAGCGAGTCGCAGGGAAGTTTTTTTTTCTCCATTTC
TTTTTCCAGGGGTATTCGGGATGACATTGAAGAGGAAGAT
GACCAAGTGAGTGACCCTCTTGACGTTACTACCGCCGTCA
TATCTTTGCCACTGCAACGACTGTGTCCCGCTACTCTTAA
TCTTTCTTTCCTGTTCATTATAAGTAGAATTAAACATCAG
TTTACAGACTGAGGCTGAGCCATTATGTTATTGGTGATGG
AGATGGTGCAAGGGAGA

ddx42 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ddx42-002 577
mRNA ddx42-201 (1) 3693
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ddx42-002 Contained in:
OTHER ddx42-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053505 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB832628 (1) 580bp
    CITATIONS (2)