ZFIN ID: ZDB-TSCRIPT-090929-10354
Transcript Name: cox6a2-002
Previous Name: zgc:103594-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027811 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027811|OTTDARG00000021760|ZDB-GENE-040912-129 cox6a2|no_translation DKEY-66I24.3-002 LG_ BX004999.8 Danio rerio protein_coding KNOWN, 677 bp
CTAATAACTGAGGGACAAAGAACAAAAACATTTGACCGAC
CCCCTTTTGAAGAGAAAATAGATGGCGATGTCCCCCACTG
CTATAGTGGCCCGCCGGGTTCTGGCTGCTGCATCAGCAGG
GAGCCACGAGGGAGGAGGAGGTTTGATATACTTAAATACA
TTTAATTCTGATCCAAGCACTCCACACAGCAACCTTTAAA
CAGAAATCAAGTGTCATCGTATTAAACCAAAATGTCAGCA
GAATGATTAGTGTGTATTTTGTTATGCTGTATATTTCAAA
TAATATGCATTAATGATCTGAATCAAAAACAGCAAGGACC
TGGAAGATACTGTCCTTCGTGTTAGCCCTTCCCGGTGTGA
GTGTCTGCATGGCAAACGTTTACCTGAAGATGCAGGCTCA
TTCCCATGAACAGCCAGAGTTTGTGCCTTACCCACACCTC
CGCATCCGAACCAAGCATTCTGTTTGTCTTTCAGCCATGG
CCTTGGGGTGATGGGAACCACTCTCTCTTCCACAACCCTC
ATACAAACGCTCTGCCCACTGGTTATGAAGGCCCTCATCA
CTGAGCGGGAAGACCTTTCATTCTGAACTGTTTGTCCTCT
CAACACTGTTTCCATTCTGCAGTGAACGAGACCAGATGTA
AACATTTTTAACAAAAATAAACTATCGATTTTACATG

cox6a2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cox6a2-202 (1)    Ensembl 523
ncRNA cox6a2-002 677
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cox6a2-002 Contained in:
[BAC] DKEY-66I24 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027811 (1),  Ensembl_Trans:ENSDART00000140547 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB974431 (1) 688 nt
CITATIONS (2)