Transcript

cox6a2-202

ID
ZDB-TSCRIPT-090929-10353
Name
cox6a2-202
Previous Names
  • cox6a2-001
  • zgc:103594-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000027810 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027810|OTTDARG00000021760|ZDB-GENE-040912-129 cox6a2|OTTDARP00000022765 DKEY-66I24.3-001 LG_ BX004999.8 Danio rerio protein_coding KNOWN, 523 bp
GGACAAACAGACAGAGGTGTAGAAAGAGAAACTGACTAAT
AACTGAGGGACAAAGAACAAAAACATTTGACCGACCCCCT
TTTGAAGAGAAAATAGATGGCGATGTCCCCCACTGCTATA
GTGGCCCGCCGGGTTCTGGCTGCTGCATCAGCAGGGAGCC
ACGAGGGAGGAGGAGCAAGGACCTGGAAGATACTGTCCTT
CGTGTTAGCCCTTCCCGGTGTGAGTGTCTGCATGGCAAAC
GTTTACCTGAAGATGCAGGCTCATTCCCATGAACAGCCAG
AGTTTGTGCCTTACCCACACCTCCGCATCCGAACCAAGCC
ATGGCCTTGGGGTGATGGGAACCACTCTCTCTTCCACAAC
CCTCATACAAACGCTCTGCCCACTGGTTATGAAGGCCCTC
ATCACTGAGCGGGAAGACCTTTCATTCTGAACTGTTTGTC
CTCTCAACACTGTTTCCATTCTGCAGTGAACGAGACCAGA
TGTAAACATTTTTAACAAAAATAAACTATCGATTTTACAT
GAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations