header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10140
Transcript Name: gbp1-201
Previous Names: gbp1-001, zgc:92185-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027592 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027592|OTTDARG00000021630|ZDB-GENE-040718-32 gbp1|OTTDARP00000022596 DKEY-97A13.3-001 LG_ BX663525.6 Danio rerio protein_coding KNOWN, 2343 bp
AGAAATCGACTGTTTAAAGTAAGCTAAAGCTATTAGGGCA
GATATTGGCAACAATCGACCTCCATAAATAGGACCCGCAT
TTCCATTCATCCCGCAGTGAGAAAGAAGGACCGTGGAGGG
TAGGAGAGCTTCGGAAGGAAGAGCTAGAAAACAGACAGGA
AGTGCTAGAAAGAACCAACATGTCTAAACCCACAATGATG
CCTTCGCCCATTTGTTTGGTGGAGAATGTGAACGGATCAC
TCAGCATCTGTAAAGATGCCATAGATTTTCTCAGTAATAT
TAATGAGCCGGTGGTGGTGGTGTCTGTGGTGGGACTCTAC
CGTACGGGGAAGTCTTACCTCATGAACCGACTAGCTGGAC
AACAGACAGGCTTTGCTCTCGGCAACACTATTGAGTCAAA
GACCAAAGGTATCTGGATGTGGTGTGTCCCTCACCCGAAA
AAACAAGGACACACTTTGGTTCTGCTGGACACAGAGGGAC
TGGGTGATGTTGACAAGGGAGACTCTAAGAACGACGGCTG
GATCTTCTGTTTGGCTGTTCTTCTCAGCAGTACTCTGGTG
TACAACAGCCGTGGCACCATCGACAACAGCGCACTGGAGA
AACTGCACTACATCACTGAGCTCACAGAGCAGATCAAGAT
CAGAACAGCAGAAGCAGCAGACGAGGAGGATGAGGAGGAC
TCAAAGTTTGTGCTTTTCTTCCCATCATTCACCTGGGTCG
TGAGAGATTTTACTTTGGATTTGGTGATTGATGGAAAGAA
TGTTAATGAAGACCAGTACCTAGATTTTGCCCTGCAGCTG
AGGAAAGGTAATAATAAGAAGGCATTGGAATACAATCTGC
CCCGTCAGTGCATTCGAAACTACTTCCCATCCCGGAAGTG
TTTTGTGTTCCCATCTCCAGCCTCACCTGAGAAGATGAAG
CAATTAGAAAGTCTGCAAGAAAAAGACCTTGTACCAGATT
TTCTGGAGGTCACAGGTCGTTTCTGTGAGCACATCTTTCG
CAACAGTGTTGTGAAAACACTGAAAGGGGGGCATAAAGTC
ACTGGTAAATTGCTTGGACATCTGGCTAAGATTTACGTGG
ACACGATCAGCAGTGGTAAAGTGCCCTGTCTGGATAACGC
CGTGGTTGCTCTGGCAAATCTAGAGAACAAGTGTGCTGTT
GAAGAAGCTTTCAAAGTGTATGAGAGAGGGATGGAAGAGG
TGAAGAAGACATTTCCAGTAAATGTGGATGAAATCTCCTC
TGAACACCAGAGGTTTAGCAGTCTGGCCAACGCTGAGTTC
ATGAAACGCTCCTTTAAAGACGAAAAACAAGAATACATTA
ATCAACTGAAAGAAAAAATCGATGTGTACTATGGATGCCT
GCTTGAAGACAATGGCTTGGCATCAAAGAAAAAGTGTGAA
GATCTGCTGAAGGATCTGTTCTCTGAAATGAATAAAAAGT
TGCAGGATGGAGTGTACAGTCAGCCTGGTGGATATGAACT
CTACTGCAAAGACAGAGACGTCATCGTTGAAAAGTACCGC
AGAGAACCCAACAAAGGTGTACTGGCCGAGGCCGTGCTGC
ATGAGTTTCTGAACGAACGAGGAGCTGAAGCAAACAGCAT
CCTCTACACAGATACAAAACTCACTGAAAACGATAAAAAG
ATTCAAGAGGAGAAGGAGAGGAATGCTTTGATGCAACAGA
AGTGTGAGGAGGAACAGGAGAAACGAATAGAGAGCGAACG
AATGATGGCGGCAGAAAAAGTGCGGCAGGATGACCAAATC
AAGCAGATGCAGGAGAAGTTTGAGAAGGAACGAGAGCAAA
TGCAGCAGGAGACGGAGAAAGCCATCGACAGCAAACTAAA
GGAGCAGGAGGAGATGCTGAATAAAGGCTTTAAGGAGAGG
GCTGATCTCCTATCTGAGGAAATCAATGATCTGAAAAAAG
AGAAGAAAGGATTTATGGAAGAATACATCATGCCTATTGT
TGGAGCTGCGGCACAAATCCTTCCTACAATTCTTGATTAC
AGAGTGATGATGAAAGGAATGAAATATGGAAAAGTAAAAA
TATAATTAATGTTTACATTTAAATCCCTGTTGTGACCAAT
TGATTGGCTGTTGACTGTTTATACAGCTTACCAGATGTAA
TCATGTTTATTTAGGAGCATAGTATTTAGTTTGATAAAAA
GTGGTGTCCTAGATCACATAGGTGTGTACTGAAAGTATCT
GCTTTGTTTCTGATGATGGAAAAATCAATGATATTAAGAT
TATTTCATAGCCCTTAATTGCACCTTGATTGCACATTCTG
CCATATTATATGTATGGATTCAAGCATTATGTTCATTTTA
ATAAATTCATTAATAAAAAAAAA

gbp1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gbp1-201 2343
gbp1-203 (1)    Ensembl 650
ncRNA gbp1-003 (1)    Ensembl 775
gbp1-004 (1)    Ensembl 902
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gbp1-201 Contained in:
[BAC] DKEY-97A13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027592 (1),  Ensembl_Trans:ENSDART00000056460 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC075920 (1) 2361 bp
CITATIONS (2)