header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10143
Transcript Name: gbp1-004
Previous Name: zgc:92185-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027595 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027595|OTTDARG00000021630|ZDB-GENE-040718-32 gbp1|no_translation DKEY-97A13.3-004 LG_ BX663525.6 Danio rerio protein_coding KNOWN, 902 bp
GCCCTCCAGAACCGAGTTTGAACACCCCTGCTCTAGTATA
TCTAGTAAGAGCTTGATTAGCTGGTTCAGGTGTTTTTGAT
TAGGGTTGGAGCTAAACTCTCCAGGACCGAGTTTGAACAC
CCCTGACATACACCATTATACACTTTATACGCAGTTGTTA
TTTCTTAATGTGCTGCAGCTACATCACTGAGCTCACAGAG
CAGATCAAGATCAGAACAGCAGAAGCAGCAGACGAGGAGG
ATGAGGAGGACTCAAAGTTTGTGCTTTTCTTCCCATCATT
CACCTGGGTCGTGAGAGATTTTACTTTGGATTTGGTGATT
GATGGAAAGAATGTTAATGAAGACCAGTACCTAGATTTTG
CCCTGCAGCTGAGGAAAGGTAATAATAAGAAGGCATTGGA
ATACAATCTGCCCCGTCAGTGCATTCGAAACTACTTCCCA
TCCCGGAAGTGTTTTGTGTTCCCATCTCCAGCCTCACCTG
AGAAGATGAAGCAATTAGAAAGTCTGCAAGAAAAAGACCT
TGTACCAGATTTTCTGGAGGTCACAGGTCGTTTCTGTGAG
CACATCTTTCGCAACAGTGTTGTGAAAACACTGAAAGGGG
GGCATAAAGTCACTGGTAAATTGCTTGGACATCTGGCTAA
GATTTACGTGGACACGATCAGCAGTGGTAAAGTGCCCTGT
CTGGATAACGCCGTGGTTGCTCTGGCAAATCTAGAGAACA
AGTGTGCTGTTGAAGAAGCTTTCAAAGTGTATGAGAGAGG
GATGGAAGAGGTGAAGAAGACATTTCCAGTAAATGTGGAT
GAAATCTCCTCTGAACACCAGAGGTTTAGCAGTCTGGCCA
ACGCTGAGTTCATGAAACGCTCCTTTAAAGACGAAAAACA
AGAATACATTAATCAACTGAAA

gbp1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA gbp1-201 (1)    Ensembl 2343
gbp1-203 (1)    Ensembl 650
ncRNA gbp1-003 (1)    Ensembl 775
gbp1-004 902
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gbp1-004 Contained in:
[BAC] DKEY-97A13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027595 (1),  Ensembl_Trans:ENSDART00000131716 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE311131 (1) 906 bp
CITATIONS (2)