Transcript

crlf1a-002

ID
ZDB-TSCRIPT-090929-10138
Name
crlf1a-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000027590 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000027590|OTTDARG00000021628|ZDB-GENE-040718-397 crlf1a|no_translation DKEY-97A13.1-002 LG_ BX663525.6 Danio rerio protein_coding KNOWN, 792 bp
AACGATGCCAAAAGTAAATGAAGAGGACGAATGCACCGTC
GCGTTAACAGAACATTTGGCGGCTCTTATGTAAAGTTCAG
TGTTGTGGAAGATCCGCGGGACGTGAGCAGCTCAGGAACC
GACGCTGGGATCAACTGTTCGGGTGCACTGGAGCTGGACT
CGGTGTGGCATGCGTGGATCTTCAGACACTCCTGCATACG
CCAATAACACGCTGTCGTGCTAATAGAAAGAAAGCGAACA
TTCCTCGTAAGATGATCTGCTTATTGTTTTTGCACCTCTG
TGCTGCCGGCGTGTTGTCGTCTTCCACCCAGGTGGCTACA
ATCTACCCTCAAGACCCCGCCCTGCTCATCGGCTCCAGCC
TGACAGCAACGTGTTCGGTCAATCCAGACCACGGCATCCA
TGCAGGCTCGCTCTACTGGACGCTGAACGGCAAGCGTCTT
CCCAGCAGCACCTACAGCATCTTAAGCCCCACTGTGATCA
GTGTCACCCTGCCCAGGCTCTCAGGGTCCCGTCAGCGCTC
TGGAGACAACCTTGTATGCCATAACGGTGGAGGTCATGTG
CTGGCCGGCTCCTGCATCTACGTTGGCAGTGAGTCCTGTC
TACCATATTGTTCCTATTTACTACAGAGTGCGCTTAATTG
GTGAATGTGCACGCAGTCCAACTTAAATACGATTAAATGG
ATTCTGTGGGTAAGCCTGGGGCCTTGGGGGAATATGGGTG
AGACTAATAGACGGTCTTCATGCATTGACCCCCTGCCACT
GAGCTGTAGTTTTTGCAGTGTTTAAAGCTGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations