header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10138
Transcript Name: crlf1a-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027590 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027590|OTTDARG00000021628|ZDB-GENE-040718-397 crlf1a|no_translation DKEY-97A13.1-002 LG_ BX663525.6 Danio rerio protein_coding KNOWN, 792 bp
AACGATGCCAAAAGTAAATGAAGAGGACGAATGCACCGTC
GCGTTAACAGAACATTTGGCGGCTCTTATGTAAAGTTCAG
TGTTGTGGAAGATCCGCGGGACGTGAGCAGCTCAGGAACC
GACGCTGGGATCAACTGTTCGGGTGCACTGGAGCTGGACT
CGGTGTGGCATGCGTGGATCTTCAGACACTCCTGCATACG
CCAATAACACGCTGTCGTGCTAATAGAAAGAAAGCGAACA
TTCCTCGTAAGATGATCTGCTTATTGTTTTTGCACCTCTG
TGCTGCCGGCGTGTTGTCGTCTTCCACCCAGGTGGCTACA
ATCTACCCTCAAGACCCCGCCCTGCTCATCGGCTCCAGCC
TGACAGCAACGTGTTCGGTCAATCCAGACCACGGCATCCA
TGCAGGCTCGCTCTACTGGACGCTGAACGGCAAGCGTCTT
CCCAGCAGCACCTACAGCATCTTAAGCCCCACTGTGATCA
GTGTCACCCTGCCCAGGCTCTCAGGGTCCCGTCAGCGCTC
TGGAGACAACCTTGTATGCCATAACGGTGGAGGTCATGTG
CTGGCCGGCTCCTGCATCTACGTTGGCAGTGAGTCCTGTC
TACCATATTGTTCCTATTTACTACAGAGTGCGCTTAATTG
GTGAATGTGCACGCAGTCCAACTTAAATACGATTAAATGG
ATTCTGTGGGTAAGCCTGGGGCCTTGGGGGAATATGGGTG
AGACTAATAGACGGTCTTCATGCATTGACCCCCTGCCACT
GAGCTGTAGTTTTTGCAGTGTTTAAAGCTGAC

crlf1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA crlf1a-002 792
mRNA crlf1a-201 (1) 2496
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
crlf1a-002 Contained in:
[BAC] DKEY-97A13 (1) (order this)

OTHER crlf1a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027590 (1)
  • Ensembl_Trans:ENSDART00000138013 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO813009 (1) 857 bp
    CITATIONS (2)