header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10137
Transcript Name: crlf1a-201
Previous Name: crlf1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027589 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027589|OTTDARG00000021628|ZDB-GENE-040718-397 crlf1a|OTTDARP00000022594 DKEY-97A13.1-001 LG_ BX663525.6 Danio rerio protein_coding KNOWN, 2496 bp
CTAGCAGTGGAGAGCCTCGGCACGGTAAACGATGCCAAAA
GTAAATGAAGAGGACGAATGCACCGTCGCGTTAACAGAAC
ATTTGGCGGCTCTTATGTAAAGTTCAGTGTTGTGGAAGAT
CCGCGGGACGTGAGCAGCTCAGGAACCGACGCTGGGATCA
ACTGTTCGGGTGCACTGGAGCTGGACTCGGTGTGGCATGC
GTGGATCTTCAGACACTCCTGCATACGCCAATAACACGCT
GTCGTGCTAATAGAAAGAAAGCGAACATTCCTCGTAAGAT
GATCTGCTTATTGTTTTTGCACCTCTGTGCTGCCGGCGTG
TTGTCGTCTTCCACCCAGGTGGCTACAATCTACCCTCAAG
ACCCCGCCCTGCTCATCGGCTCCAGCCTGACAGCAACGTG
TTCGGTCAATCCAGACCACGGCATCCATGCAGGCTCGCTC
TACTGGACGCTGAACGGCAAGCGTCTTCCCAGCAGCACCT
ACAGCATCTTAAGCCCCACTGTGATCAGTGTCACCCTGCC
CAGGCTCTCAGGGTCCCGTCAGCGCTCTGGAGACAACCTT
GTATGCCATAACGGTGGAGGTCATGTGCTGGCCGGCTCCT
GCATCTACGTTGGCATGCCTCCTGAGAAGCCTGTGAATCT
TACCTGCTGGTCCAGGAACACTAAAGACCTCACCTGTAGA
TGGGCCCCTGGGGGCCAGGGGGAAACCTTCATCAAGACAA
AATACACACTCAAATATAAGCTCAGGTGGTACGGACGGGA
GAAGGAGTGTGAGGACTACAGCACGGGAGAACCATACACG
TGCTACATCCCCCGCGACCTCGCCCTCTTCACGCCCTATG
AGATATGGGTGGAGGCGTCCAACCAACTCGGAACCGCAAC
GTCTGACGTCATCTACCTGGATATCTTAGACGTGGTGACG
ACAGATCCACCGACTGATGTGACGGTGAGCCGAGTTGGAG
ATCTGGAGGACCAGCTGACCGTGCGCTGGGGGACACCGCC
GGCACTCAAAGACTTCCTATTTCAGGCCAAATACCAAATC
CGATACAGACTGGAGGAAAGCAGCGACTGGAAGGTGGTGG
ATGATGTTGGAAACCAGACTTCCTGCAGGCTGGCAGGGTT
GCGGCCGGGCACAGTGTATTTTGTGCAGGTGCGCTGTAAT
CCGGTGGGGATTCTGGGATCTAGGAAAGCAGGCATTTGGA
GCGACTGGAGTCACCCAACTGCAGCCTCAACACCACACAG
TGAGCGGTTGTTGACAGGGTCATGCGACTCGAAGGCCGGA
CAGCAGAACTCAACGCTACGGCGGGATTTAAAGCAGTTTT
TCGGCTGGGTGCGCAAACATGCTTACGGTTGTAGCGGGAT
GAGCATCAAACTTTATGATCAGTGGAGGGTCTGGCTGCAG
AAATCTCACAAAACTCGCAACCAGGTTCTTCAAGGAGATA
AATCATAGCACGTCGCTGCTGGCAGGCAGAAAGAACACTT
AACAACAACAGCACACTGTGGAAAAAACTCACATTTTCCA
GACCGCTGCTTGACTCAGTGCAGGAAAGTTAAAGTACAGC
TGGACTCACAAACGGGATGTTCAAACAACAAAAGGTGACG
GGCATTTGGGGCTCTTGGACACAGATTTCATTGTGCGGTT
CGCTAAAATGCCTTATAATAACAAAAACAAACGGTTAAAT
GTTTTTCTTTGACATTAGCCATGAAGATCTGGTGGACTAT
ATCCTCGCAACTCGCAATCCGTGAAGATTTTTTGACCATG
TCGAGGAAGCAATTAATTAAAGGTCATAATTTGCACATGT
TTAATAAGGATGACTTCGATGTGACACATGGTCTGAACGC
GGACACGTGGCGTTTTCTGATCTGTGTGCTATAAGCGATT
CATCCTCATGGACAAACGGGAAACTTATGAACGTTTTTCA
GTGTAACTTTAAGACAACTGGACGAATAATAAGGCCATCC
AGTTTTACCAAAGGTATCATTTATGAATGTTTGAGTGTGA
CAGACTTTATATTCCAGCAGAAAATGTTGACAGGTATACC
TCACAAAACACTTTGTAGTCTGCTATTTCGTTAACTGGTA
CGTGCCATATCAAAAGTTGATCCCATGCAATGCTGAAAAT
ATCATAAAACTAAGTCTCGCTGCATTTGAAACTCAACCAC
AAACATTGGAGGATTTCAAATTTGACATGTTGGATCCCCA
AAGTGGACTCAAAAGTGGCCACGAGGAAGATTTTGGCCAG
CCAATGTTCTCTTTTGTTTATACATGTGTTGCCGTTAGCA
AACGTCAAGTGTGTTTGTAGCATTGAACTGTTTGAAAATA
ATTTTATGTATTGAGACATTTTACTACTTTTATTTTTGTA
CTGAATTTGTATCCACATATTTAAATGTAAAGTTATGTTT
CGATTCTTAAGTTATGTGTAGGTAGATTATATTATTATTG
ACTGAATTGTTAAGCTCTAATATTGTGCATAAAATCCTTC
TTTAAGATCCGACTTA

crlf1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA crlf1a-002 (1) 792
mRNA crlf1a-201 2496
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
crlf1a-201 Contained in:
[BAC] DKEY-97A13 (1) (order this)

OTHER crlf1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027589 (1)
  • Ensembl_Trans:ENSDART00000112243 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC076526 (1) 2520 bp
    GenBank:CK017955 (1) 913 bp
    CITATIONS (2)