header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10110
Transcript Name: astn1-203
Previous Names: astn1-003, zgc:113405-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027558 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027558|OTTDARG00000021609|ZDB-GENE-050320-140 astn1|OTTDARP00000022573 DKEY-21A8.1-003 LG_none CU929050.6,BX530027.11,BX649439.8 Danio rerio protein_coding KNOWN, 937 bp
AAGGTAAACTCATGCTTATGTAATGGGAGTGGTGCAGTCA
TGCATTTTGATTTTAATGGTGGTATATGCTGTTATATGAT
TACATAATTCACACACTGAAACAATTTGTTGACTCTGAAC
TTCAAAAGAGTCCTAAAAAGGTTTCGGCTGTGGGCAGTGG
ACAACACGGGTCGGCGCTCCAGTCCGAGTGAGGTGACGAT
CAAAACTCCTTGTCCTGCTGTGGATGATGTCAAGGCTCAA
GAAATAGCAGATAAGATTTACAATCTGTTCAACGGCTACA
CCAGCGGGAAGGAGCAGCAGACGGCCTATAATACACTCAT
GGATCTGGGATCACCAACCCTCCACCGAGTTCTATACCAC
TACAATCAGCGCTACGAGAGTTTTGGAGAGTTCACCTGGC
GATGTGAAGATGAACTTGGTCCAAGGAAGGCAGGACTGAT
CCTGTCTCAGCTGGATGAGCTCAGCGGTTGGTGTCGGGGG
CTCCTCCAGGAACCAAAGATTGGCCTGCGCAGAGCATCCC
TCAAGTATCTGTCTTGTCGATACACAGATACCAAAGCGTT
CGGGCTCAGCTGGGTGAACCTCGGCCAAGACTTGCGTAAG
GCCTGCGAGGAGCAGATGCTGTCCGTGATGTACAACGATT
ATGGAGAACCCAAGGAACTTTAAAGGACTTGGACAACCAG
AGGACTAGTCAGGGGTCCAACTGTAAATATGACTTCTCTG
CTCCATCGCTTTTAACATTAATTGGTCGTTTATCGAGGAA
GAGGGAAATATTTAGTCAGAACGTGATACAGTTCGTTCTG
ATTTTAAGAAGCGTTCAAGAGATACGACTTCAGGCCTGCG
TATTCAAAATATGTACAGTGTACAGTCAAAAGGAAGTTAC
ATTTAAAGTGTCATTTAGAACTAGTGGTGTATTTTGTCAA
ACGGTGCATACACCAGC

astn1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA astn1-202 (1)    Ensembl 1288
astn1-203 937
astn1-204 (1)    Ensembl 2344
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
astn1-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000027558 (1),  Ensembl_Trans:ENSDART00000141796 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CN024699 (1) 952 bp
GenBank:CO248214 (1) 835 bp
GenBank:CV108279 (1) 699 bp
GenBank:CB360581 (1) 570 bp
CITATIONS (2)