ZFIN ID: ZDB-TSCRIPT-090929-10108
Transcript Name: astn1-202
Previous Names: astn1-002, zgc:113405-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027556 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027556|OTTDARG00000021609|ZDB-GENE-050320-140 astn1|OTTDARP00000022571 DKEY-21A8.1-002 LG_none CU929050.6,BX530027.11,BX649439.8 Danio rerio protein_coding KNOWN, 1288 bp
GATCTCACCAAAGCAGAGTGCAGGTGGCGGCTGTGTCTGA
TCTCCTCCACTAGATGGAGATAGAGTTCCAGCTAAACTTC
AGTCATAGAGTGAGTGAGTGCTAGTACACACATCGAGCAC
AGCTGGTTGCTATTGTTCAACTTCAGTTGTCTGCACTTAA
GAGATCTTCAAATCAAAGCCATGAGCCCAAGGTTTCGGCT
GTGGGCAGTGGACAACACGGGTCGGCGCTCCAGTCCGAGT
GAGGTGACGATCAAAACTCCTTGTCCTGCTGTGGATGATG
TCAAGGCTCAAGAAATAGCAGATAAGATTTACAATCTGTT
CAACGGCTACACCAGCGGGAAGGAGCAGCAGACGGCCTAT
AATACACTCATGGATCTGGGATCACCAACCCTCCACCGAG
TTCTATACCACTACAATCAGCGCTACGAGAGTTTTGGAGA
GTTCACCTGGCGATGTGAAGATGAACTTGGTCCAAGGAAG
GCAGGACTGATCCTGTCTCAGCTGGATGAGCTCAGCGGTT
GGTGTCGGGGGCTCCTCCAGGAACCAAAGATTGGCCTGCG
CAGAGCATCCCTCAAGTATCTGTCTTGTCGATACACAGAT
ACCAAAGCGTTCGGGCTCAGCTGGGTGAACCTCGGCCAAG
ACTTGCGTAAGGCCTGCGAGGAGCAGATGCTGTCCGTGAT
GTACAACGATTATGGAGAACCCAAGGAACTTTAAAGGACT
TGGACAACCAGAGGACTAGTCAGGGGTCCAACTGTAAATA
TGACTTCTCTGCTCCATCGCTTTTAACATTAATTGGTCGT
TTATCGAGGAAGAGGGAAATATTTAGTCAGAACGTGATAC
AGTTCGTTCTGATTTTAAGAAGCGTTCAAGAGATACGACT
TCAGGCCTGCGTATTCAAAATATGTACAGTGTACAGTCAA
AAGGAAGTTACATTTAAAGTGTCATTTAGAACTAGTGGTG
TATTTTGTCAAACGGTGCATACACCAGCTTGTATAGGTAG
AACTTTTTTCACAAGAACTAAAAGTGTATCTTCTTAATGT
GCTGAAAAAAAAAACGTCTGTCTCTGTAGTGCATATAGAT
ATGGAAAGAGCTATAGCAAATGTAAATGTGAATTCATTAT
TAAATACATTACTGATGTGCTGAATGTAGTAACTAAGGTA
TAAGAGGTGGAGGAAACTGTACATGAGGTTTTTTAAAGTA
TAAGCAGTATTATGAAAATAAGCATTTTAAAGTTGTACAA
TAACATGATGTCTTGTTTATGGTTTATTTCCTATTCCAAA
TAAAATTG

astn1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA astn1-202 1288
astn1-203 (1)    Ensembl 937
astn1-204 (1)    Ensembl 2344
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
astn1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000027556 (1),  Ensembl_Trans:ENSDART00000134926 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC090511 (1) 1280 bp
GenBank:CO794993 (1) 793 bp
CITATIONS (2)