header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10066
Transcript Name: clta-005
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027512 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027512|OTTDARG00000021585|ZDB-GENE-040426-1986 clta|no_translation clta-005 LG_ CT033816.7 Danio rerio protein_coding KNOWN, 840 bp
CTGACATTGGAGCCGTCGACGAGGAAGACAGTAGGGTGAT
TAGTGTTTTCGGTTGTTCTCCCTCTGAGCACATTCAGCAA
GCCATGGACGATTTCGATATGCTCAGTGCCCCTCAAGGAA
GCGCAGGGAACGGTGTCGGGGCAGACGAGGACCCGGCGGC
GGCATTTCTGGCCCAGCAAGAGAGCGAGATCGCTGGCATC
GAGAATGACGAGGGCTTCAGCATCCTGGACAGCGGAGATG
TGCCTTCGTCCCTGAGCCAAGACCAGGACGGTGGAGCAAT
GAATGGAGATCTGCATGGGGAGAGTAATGGCCCTTCAGAT
GTGTACGCGGCCATCTCCAGTGTGGATCGGTTGCAGGCTG
AGCCGGAGAGCTTGAGGAAGTGGAGAGAGGAGCAGCGAGA
TAGGCTGGAGGAGCTCGATGCGAACTCGCGTAAACAGGAG
GCCGAGTGGAAAGAGAAGGCAAAGCTGGAGCTGGAGGAAT
GGCACACCAGGCAGAACGAGCAGCTGGAGAAAACCAAAGT
CAACAACAGGTACAAAACACTGTTCGAGCAGAAGAAATCA
ACAAGGCAGGCCTAGTTTCTGGCTTTTGCTGTGCGATTAC
AAGAGCACAAGACCTGCACAGTTTAGTTTCAACCCTGCTT
CAATACACTTACCCAGAGGTGTAAAACAAGCCTCAAGGAC
TCCATTAGTTTGATTAAGTGTGCTTAATAAGGGTCAAAGC
TAAACTATGTAGAGCTAAGGACCTCCACAAACTGAGTTTG
ACACCTGTGCACTAGACAGTGCATGGCTCCCTTTATTACT
CCATTTGTATATTAAAAAAAAGTTTTACACAGCATTAAAA

clta TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA clta-004 (1) 806
clta-005 840
clta-006 (1) 883
mRNA clta-201 (1) 1338
clta-203 (1) 992
clta-206 (1) 754
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
clta-005 Contained in:
OTHER clta-005 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027512 (1)
  • Ensembl_Trans:ENSDART00000142900 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN326548 (1) 825bp
    GenBank:DT882177 (1) 810bp
    GenBank:EB959088 (1) 766bp
    CITATIONS (2)