header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-10064
Transcript Name: clta-203
Previous Name: clta-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027510 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027510|OTTDARG00000021585|ZDB-GENE-040426-1986 clta|OTTDARP00000022535 clta-003 LG_ CT033816.7 Danio rerio protein_coding KNOWN, 992 bp
CCCCACTGACATTGGAGCCGTCGACGAGGAAGACAGTAGG
GTGATTAGTGTTTTCGGTTGTTCTCCCTCTGAGCACATTC
AGCAAGCCATGGACGATTTCGATATGCTCAGTGCCCCTCA
AGGAAGCGCAGGGAACGGTGTCGGGGCAGACGAGGACCCG
GCGGCGGCATTTCTGGCCCAGCAAGAGAGCGAGATCGCTG
GCATCGAGAATGACGAGGGCTTCAGCATCCTGGACAGCGG
AGATGTGCCTTCGTCCCTGAGCCAAGACCAGGACGGTGGA
GCAATGAATGGAGATCTGCATGGGGAGAGTAATGGCCCTT
CAGATGTGTACGCGGCCATCTCCAGTGTGGATCGGTTGCA
GGCTGAGCCGGAGAGCTTGAGGAAGTGGAGAGAGGAGCAG
CGAGATAGGCTGGAGGAGCTCGATGCGAACTCGCGTAAAC
AGGAGGCCGAGTGGAAAGAGAAGGCAAAGCTGGAGCTGGA
GGAATGGCACACCAGGCAGAACGAGCAGCTGGAGAAAACC
AAAGTCAACAACAGGGTGCTGGATGAGGATTTCTACAAAC
AACCCTTCGCTGATCTGATTGGTTATGTGGCGGCTGAGGA
AGCCATGGTGTCGGAGCTGGATGAAAACAGTCCTGGCACA
GAATGGGAACGTGTGGCGCGTCTTTGCGATTTCAACCCTA
AATCCAGCAAGCAGGCAAAGGATGTGTCCCGCATGCGTTC
AGTGCTCATCTCTCTTAAACAGGCTCCGCTCGTCCGCTAA
ACAGCTTCAAAGTAAACGAAAATCCAACAATCCCAGCAAC
CATTGGGTTTCACAACATCGATTTCCTTTGTGGCCCTATC
CCAATGGCTTTGAGCTCCATATATGAATAATCTATATTAT
ATTATATGTATGTGTAATATGATATAGTTATGTCTATAAA
TATTTCATCTATAAATATATACATGCATACATAAATATAT
ATAACAATGTTTTTATTTTTGGTGTCTATTTT

clta TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA clta-004 (1) 806
clta-005 (1) 840
clta-006 (1) 883
mRNA clta-201 (1) 1338
clta-203 992
clta-206 (1) 754
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
clta-203 Contained in:
OTHER clta-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027510 (1)
  • Ensembl_Trans:ENSDART00000138759 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK395463 (1) 842bp
    GenBank:CO957886 (1) 815bp
    GenBank:DV598707 (1) 745bp
    GenBank:EB940278 (1) 566bp
    CITATIONS (2)