ZFIN ID: ZDB-TSCRIPT-090929-10062
Transcript Name: clta-201
Previous Name: clta-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027508 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027508|OTTDARG00000021585|ZDB-GENE-040426-1986 clta|OTTDARP00000022533 clta-001 LG_ CT033816.7 Danio rerio protein_coding KNOWN, 1338 bp
CCCCACTGACATTGGAGCCGTCGACGAGGAAGACAGTAGG
GTGATTAGTGTTTTCGGTTGTTCTCCCTCTGAGCACATTC
AGCAAGCCATGGACGATTTCGATATGCTCAGTGCCCCTCA
AGGAAGCGCAGGGAACGGTGTCGGGGCAGACGAGGACCCG
GCGGCGGCATTTCTGGCCCAGCAAGAGAGCGAGATCGCTG
GCATCGAGAATGACGAGGGCTTCAGCATCCTGGACAGCGG
AGATGTGCCTTCGTCCCTGAGCCAAGACCAGGACGGTGGA
GCAATGAATGGAGATCTGCATGGGGAGAGTAATGGCCCTT
CAGATGTGTACGCGGCCATCTCCAGTGTGGATCGGTTGCA
GGCTGAGCCGGAGAGCTTGAGGAAGTGGAGAGAGGAGCAG
CGAGATAGGCTGGAGGAGCTCGATGCGAACTCGCGTAAAC
AGGAGGCCGAGTGGAAAGAGAAGGCAAAGCTGGAGCTGGA
GGAATGGCACACCAGGCAGAACGAGCAGCTGGAGAAAACC
AAAGTCAACAACAGGGTGCTGGATGAGGATTTCTACAAAC
AACCCTTCGCTGATCTGATTGGTTATGTCACTCACATTAA
CCATCCTTGCTACCGCCTAGACCAGGCGGCTGAGGAAGCC
ATGGTGTCGGAGCTGGATGAAAACAGTCCTGGCACAGAAT
GGGAACGTGTGGCGCGTCTTTGCGATTTCAACCCTAAATC
CAGCAAGCAGGCAAAGGATGTGTCCCGCATGCGTTCAGTG
CTCATCTCTCTTAAACAGGCTCCGCTCGTCCGCTAAACAG
CTTCAAAGTAAACGAAAATCCAACAATCCCAGCAACCATT
GGGTTTCACAACATCGATTTCCTTTGTGGCCCTATCCCAA
TGGCTTTGAGCTCCATATATGAATAATCTATATTATATTA
TATGTATGTGTAATATGATATAGTTATGTCTATAAATATT
TCATCTATAAATATATACATGCATACATAAATATATATAA
CAATGTTTTTATTTTTGGTGTCTATTTTATGGACCAAACT
CCATGTTCCACCTATTTTTCCCCTCGCCGTGTAGAGCCAG
CGTGTGGCATTGTGACACTATCGATCTATGCATTTCCCTC
GTGAATCTGTTGGGGAATCCAGTACTGACGTCTTGTGTAT
GTTGTATACAGATGGTGTGCGTGTGTGTGACTGTACATAA
AGACTGGTCTTCTACACTTCATTGTGAGATTATGGCACAA
GTTGTTGTTGTTGTTGTTAAACAGAGCTGTACCCCGGTAA
ACGTTAACTCATGTTGTCCATTCTGTTTCAGTTTGATTAA
ACACATTTGAAATGGTAA

clta TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA clta-004 (1) 806
clta-005 (1) 840
clta-006 (1) 883
mRNA clta-201 1338
clta-203 (1) 992
clta-206 (1) 754
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
clta-201 Contained in:
OTHER clta-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000027508 (1)
  • Ensembl_Trans:ENSDART00000067082 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC060939 (1) 1329bp
    GenBank:CK360339 (1) 786bp
    GenBank:CB357977 (1) 570bp
    CITATIONS (2)