ZFIN ID: ZDB-TALEN-171120-2
TALEN Name: TALEN2-cdkn2a/b
Target: cdkn2a/b (1)
Source:
Target Sequence 1:
5' - TTTCTAACGGAGTGAATGCC - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - TATAGGCGTTCTTCTAAATT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN2-cdkn2a/b No data available
GENOMIC FEATURES CREATED WITH TALEN2-cdkn2a/bNo data available
GENE EXPRESSION
Gene expression in Wild Types + TALEN2-cdkn2a/b No data available
PHENOTYPE
Phenotype resulting from TALEN2-cdkn2a/b
No data available

Phenotype of all Fish created by or utilizing TALEN2-cdkn2a/b
Phenotype Fish Conditions Figures
whole organism decreased life span, abnormal tp53zdf1/zdf1 + TALEN2-cdkn2a/b standard conditions Fig. 1 with image from Shim et al., 2017
eye anatomical region neoplastic, exacerbated tp53zdf1/zdf1 + TALEN2-cdkn2a/b standard conditions Fig. 1 with image from Shim et al., 2017
eye neurofibrosarcoma increased amount, exacerbated tp53zdf1/zdf1 + TALEN2-cdkn2a/b standard conditions Fig. 1 with image from Shim et al., 2017
OTHER TALEN2-cdkn2a/b TALEN PAGESNo links to external sites
CITATIONS (1)