TALEN

TALEN1-notch2

ID
ZDB-TALEN-150129-1
Name
TALEN1-notch2
Previous Names
None
Target
Target Sequence 1
5' - TTGTGTGAACACCATAGGCT - 3'
Target Sequence 2
5' - TCCGGTGAAGCCAGGTTGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
el515 notch2
el517 notch2
Expression
Gene expression in Wild Types + TALEN1-notch2
No data available
Phenotype
Phenotype resulting from TALEN1-notch2
No data available
Phenotype of all Fish created by or utilizing TALEN1-notch2
Citations