ZFIN ID: ZDB-TALEN-150129-1
TALEN Name: TALEN1-notch2
Target: notch2 (1)
Source:
Target Sequence 1:
5' - TTGTGTGAACACCATAGGCT - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - TCCGGTGAAGCCAGGTTGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-notch2 No data available
GENOMIC FEATURES CREATED WITH TALEN1-notch2
Genomic Feature Affected Genomic Regions    
el515 notch2    
el517 notch2    
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-notch2 No data available
PHENOTYPE
Phenotype resulting from TALEN1-notch2
No data available

Phenotype of all Fish created by or utilizing TALEN1-notch2
Phenotype Fish Conditions Figures
vasculature development process quality, abnormal notch2el517/el517 standard conditions Fig. S5 from Kim et al., 2014
pharyngeal arch 1 barx1 expression increased distribution, abnormal notch2el515/el515 ; notch3fh332/fh332 standard conditions Fig. 3 with image from Barske et al., 2016
pharyngeal arch 2 barx1 expression increased distribution, abnormal notch2el515/el515 ; notch3fh332/fh332 standard conditions Fig. 3 with image from Barske et al., 2016
OTHER TALEN1-notch2 TALEN PAGESNo links to external sites
CITATIONS (4)