Morpholino

MO6-gja1b

ID
ZDB-MRPHLNO-201130-2
Name
MO6-gja1b
Previous Names
None
Target
Sequence
5' - TCCCAACGCACTCCAGTCACCCATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-gja1b
No data available
Phenotype
Phenotype resulting from MO6-gja1b
Phenotype of all Fish created by or utilizing MO6-gja1b
Citations