Morpholino

MO2-cited2

ID
ZDB-MRPHLNO-200114-2
Name
MO2-cited2
Previous Names
None
Target
Sequence
5' - AACTTTGTAACCTTTACCTCTCCGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cited2
No data available
Phenotype
Phenotype resulting from MO2-cited2
Phenotype Fish Figures
atrium increased size, abnormal AB + MO2-cited2 Fig. 5 with image from Santos et al., 2019
cardiac ventricle increased size, abnormal AB + MO2-cited2 Fig. 5 with image from Santos et al., 2019
cardiovascular system morphology, abnormal AB + MO2-cited2 Fig. 5 with image from Santos et al., 2019
caudal fin curved, abnormal AB + MO2-cited2 Fig. S3 with image from Santos et al., 2019
embryo development arrested, abnormal AB + MO2-cited2 Fig. 4 with image from Santos et al., 2019
embryo development delayed, abnormal AB + MO2-cited2 Fig. 4 with image from Santos et al., 2019
heart contraction decreased rate, abnormal AB + MO2-cited2 Fig. 5 with image from Santos et al., 2019
heart tube morphology, abnormal AB + MO2-cited2 Fig. 5 with image from Santos et al., 2019
notochord morphology, abnormal AB + MO2-cited2 Fig. S3 with image from Santos et al., 2019
pericardium edematous, abnormal AB + MO2-cited2 Fig. S3 with image from Santos et al., 2019
pericardium structure, abnormal AB + MO2-cited2 Fig. 5 with image from Santos et al., 2019
whole organism curved, abnormal AB + MO2-cited2 Fig. S3 with image from Santos et al., 2019
whole organism decreased life span, abnormal AB + MO2-cited2 Fig. 4 with image,  Fig. 5 with image from Santos et al., 2019
yolk edematous, abnormal AB + MO2-cited2 Fig. S3 with image from Santos et al., 2019
Phenotype of all Fish created by or utilizing MO2-cited2
Phenotype Fish Conditions Figures
caudal fin curved, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. S3 with image from Santos et al., 2019
heart contraction decreased rate, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. 5 with image from Santos et al., 2019
atrium increased size, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. 5 with image from Santos et al., 2019
notochord morphology, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. S3 with image from Santos et al., 2019
heart tube morphology, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. 5 with image from Santos et al., 2019
cardiovascular system morphology, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. 5 with image from Santos et al., 2019
yolk edematous, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. S3 with image from Santos et al., 2019
embryo development delayed, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. 4 with image from Santos et al., 2019
embryo development arrested, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. 4 with image from Santos et al., 2019
pericardium structure, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. 5 with image from Santos et al., 2019
cardiac ventricle increased size, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. 5 with image from Santos et al., 2019
whole organism curved, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. S3 with image from Santos et al., 2019
whole organism decreased life span, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. 4 with image,  Fig. 5 with image from Santos et al., 2019
pericardium edematous, abnormal AB + MO1-cited2 + MO2-cited2 standard conditions Fig. S3 with image from Santos et al., 2019
caudal fin curved, abnormal AB + MO2-cited2 standard conditions Fig. S3 with image from Santos et al., 2019
heart contraction decreased rate, abnormal AB + MO2-cited2 standard conditions Fig. 5 with image from Santos et al., 2019
atrium increased size, abnormal AB + MO2-cited2 standard conditions Fig. 5 with image from Santos et al., 2019
notochord morphology, abnormal AB + MO2-cited2 standard conditions Fig. S3 with image from Santos et al., 2019
heart tube morphology, abnormal AB + MO2-cited2 standard conditions Fig. 5 with image from Santos et al., 2019
yolk edematous, abnormal AB + MO2-cited2 standard conditions Fig. S3 with image from Santos et al., 2019
cardiovascular system morphology, abnormal AB + MO2-cited2 standard conditions Fig. 5 with image from Santos et al., 2019
embryo development arrested, abnormal AB + MO2-cited2 standard conditions Fig. 4 with image from Santos et al., 2019
embryo development delayed, abnormal AB + MO2-cited2 standard conditions Fig. 4 with image from Santos et al., 2019
cardiac ventricle increased size, abnormal AB + MO2-cited2 standard conditions Fig. 5 with image from Santos et al., 2019
pericardium structure, abnormal AB + MO2-cited2 standard conditions Fig. 5 with image from Santos et al., 2019
whole organism decreased life span, abnormal AB + MO2-cited2 standard conditions Fig. 4 with image,  Fig. 5 with image from Santos et al., 2019
whole organism curved, abnormal AB + MO2-cited2 standard conditions Fig. S3 with image from Santos et al., 2019
pericardium edematous, abnormal AB + MO2-cited2 standard conditions Fig. S3 with image from Santos et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.