Morpholino

MO1-eng

ID
ZDB-MRPHLNO-191113-6
Name
MO1-eng
Previous Names
None
Target
Sequence
5' - GATGAACTCAACACTCGTGTCTGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-eng
Phenotype
Phenotype resulting from MO1-eng
Phenotype Fish Figures
blood island bmper expression decreased distribution, abnormal WT + MO1-eng Figure 5 with image from Zhang et al., 2019
blood vessel endothelium aplnra expression decreased amount, abnormal WT + MO1-eng Fig. 1 from Wang et al., 2020
blood vessel endothelium nrp1a expression decreased amount, abnormal WT + MO1-eng Fig. 1 from Wang et al., 2020
brain kdrl expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
brain flt4 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
brain cdh5 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
dorsal aorta cdh5 expression decreased distribution, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
endothelial cell lmo2 expression decreased distribution, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
endothelial cell hey2 expression decreased distribution, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
endothelial cell kdrl expression decreased distribution, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
endothelial cell spi1b expression decreased distribution, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
intersegmental vein broken, abnormal y1Tg + MO1-eng Figure 3 with image from Zhang et al., 2019
intersegmental vein EGFP expression decreased distribution, abnormal y1Tg + MO1-eng Figure 5 with image from Zhang et al., 2019
intersegmental vein EGFP expression spatial pattern, abnormal y1Tg + MO1-eng Figure 3 with image from Zhang et al., 2019
posterior cardinal vein cdh5 expression decreased distribution, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
trunk dll4 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
trunk cdh5 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
trunk kdrl expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
trunk flt4 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
vasculature EGFP expression decreased distribution, abnormal y1Tg + MO1-eng Figure 5 with image from Zhang et al., 2019
whole organism id3 expression decreased amount, abnormal WT + MO1-eng Figure 3 with image from Zhang et al., 2019
whole organism kdrl expression decreased amount, abnormal WT + MO1-eng Figure 4 with imageFigure 5 with image from Zhang et al., 2019
whole organism flt4 expression decreased amount, abnormal WT + MO1-eng Figure 5 with image from Zhang et al., 2019
whole organism bmper expression decreased amount, abnormal WT + MO1-eng Figure 5 with image from Zhang et al., 2019
whole organism spi1b expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
whole organism lmo2 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
whole organism id1 expression decreased amount, abnormal WT + MO1-eng Figure 3 with image from Zhang et al., 2019
whole organism jdp2b expression decreased amount, abnormal WT + MO1-eng Figure 3 with image from Zhang et al., 2019
whole organism dll4 expression decreased amount, abnormal WT + MO1-eng Figure 5 with image from Zhang et al., 2019
whole organism hey2 expression decreased amount, abnormal WT + MO1-eng Figure 4 with image from Zhang et al., 2019
whole organism cdh5 expression decreased amount, abnormal WT + MO1-eng Figure 4 with imageFigure 5 with image from Zhang et al., 2019
Phenotype of all Fish created by or utilizing MO1-eng
Phenotype Fish Conditions Figures
whole organism cdh5 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with imageFigure 5 with image from Zhang et al., 2019
blood vessel endothelium nrp1a expression decreased amount, abnormal WT + MO1-eng standard conditions Fig. 1 from Wang et al., 2020
dorsal aorta blood vessel endothelial cell decreased area, abnormal WT + MO1-eng chemical treatment by environment: inhibitor Fig. 9 from Klems et al., 2020
whole organism hey2 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
whole organism spi1b expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
whole organism id1 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 3 with image from Zhang et al., 2019
whole organism flt4 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 5 with image from Zhang et al., 2019
trunk kdrl expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
whole organism kdrl expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with imageFigure 5 with image from Zhang et al., 2019
trunk dll4 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
dorsal aorta decreased diameter, abnormal WT + MO1-eng chemical treatment by environment: inhibitor Fig. 9 from Klems et al., 2020
endothelial cell hey2 expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
trunk flt4 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
dorsal aorta cdh5 expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
brain flt4 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
whole organism id3 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 3 with image from Zhang et al., 2019
whole organism dll4 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 5 with image from Zhang et al., 2019
brain cdh5 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
blood island bmper expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 5 with image from Zhang et al., 2019
endothelial cell spi1b expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
brain kdrl expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
whole organism jdp2b expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 3 with image from Zhang et al., 2019
whole organism lmo2 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
whole organism bmper expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 5 with image from Zhang et al., 2019
endothelial cell kdrl expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
trunk cdh5 expression decreased amount, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
blood vessel endothelium aplnra expression decreased amount, abnormal WT + MO1-eng standard conditions Fig. 1 from Wang et al., 2020
posterior cardinal vein cdh5 expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
endothelial cell lmo2 expression decreased distribution, abnormal WT + MO1-eng standard conditions Figure 4 with image from Zhang et al., 2019
intersegmental vein EGFP expression spatial pattern, abnormal y1Tg + MO1-eng standard conditions Figure 3 with image from Zhang et al., 2019
intersegmental vein EGFP expression decreased distribution, abnormal y1Tg + MO1-eng standard conditions Figure 5 with image from Zhang et al., 2019
vasculature EGFP expression decreased distribution, abnormal y1Tg + MO1-eng standard conditions Figure 5 with image from Zhang et al., 2019
intersegmental vein broken, abnormal y1Tg + MO1-eng standard conditions Figure 3 with image from Zhang et al., 2019
dorsal aorta decreased diameter, abnormal WT + MO1-eng + MO1-trioa standard conditions Fig. 9 from Klems et al., 2020
dorsal aorta blood vessel endothelial cell decreased area, abnormal WT + MO1-eng + MO1-trioa standard conditions Fig. 9 from Klems et al., 2020
Citations