Morpholino

MO1-drll.3

ID
ZDB-MRPHLNO-190729-2
Name
MO1-drll.3
Previous Names
None
Target
Sequence
5' - ATACTTGGTTTACCAACCTCTTTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-drll.3
Expressed Gene Anatomy Figures
drll.3 Fig. 2 with image,  Fig. 4 with image from Pimtong et al., 2014
gata1a Fig. 3 with image,  Fig. 5 with image from Pimtong et al., 2014
gata1b Fig. 4 with image from Pimtong et al., 2014
hbae1.1 Fig. 3 with image,  Fig. 4 with image from Pimtong et al., 2014
lcp1 Fig. 5 with image from Pimtong et al., 2014
lyz Fig. 4 with image from Pimtong et al., 2014
mpx Fig. 4 with image from Pimtong et al., 2014
runx1 Fig. 4 with image from Pimtong et al., 2014
slc4a1a Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Pimtong et al., 2014
spi1b Fig. 4 with image from Pimtong et al., 2014
tal1 Fig. 4 with image from Pimtong et al., 2014
Phenotype
Phenotype resulting from MO1-drll.3
Phenotype Fish Figures
blood island edematous, abnormal y1Tg + MO1-drll.3 Fig. 3 with image from Pimtong et al., 2014
circulating cell nucleate erythrocyte decreased amount, abnormal sd2Tg + MO1-drll.3 Fig. 3 with image from Pimtong et al., 2014
common myeloid progenitor decreased amount, abnormal AB + MO1-drll.3 Fig. 4 with image from Pimtong et al., 2014
common myeloid progenitor spi1b expression decreased amount, abnormal AB + MO1-drll.3 Fig. 4 with image from Pimtong et al., 2014
erythrocyte differentiation decreased occurrence, abnormal AB + MO1-drll.3 Fig. 3 with image from Pimtong et al., 2014
erythrocyte maturation decreased occurrence, abnormal sd2Tg + MO1-drll.3 Fig. 7 with image from Pimtong et al., 2014
erythroid lineage cell decreased amount, abnormal AB + MO1-drll.3 Fig. 3 with image,  Fig. 4 with image from Pimtong et al., 2014
erythroid lineage cell gata1a expression decreased amount, abnormal AB + MO1-drll.3 Fig. 3 with image,  Fig. 5 with image from Pimtong et al., 2014
erythroid lineage cell slc4a1a expression decreased amount, abnormal AB + MO1-drll.3 Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Pimtong et al., 2014
granulocyte decreased amount, abnormal AB + MO1-drll.3 Fig. 4 with image from Pimtong et al., 2014
granulocyte mpx expression decreased amount, abnormal AB + MO1-drll.3 Fig. 4 with image from Pimtong et al., 2014
monocyte lcp1 expression decreased amount, abnormal AB + MO1-drll.3 Fig. 5 with image from Pimtong et al., 2014
myeloid cell lyz expression decreased amount, abnormal AB + MO1-drll.3 Fig. 4 with image from Pimtong et al., 2014
myeloid cell decreased amount, abnormal AB + MO1-drll.3 Fig. 4 with image from Pimtong et al., 2014
nucleate erythrocyte hbae1.1 expression decreased amount, abnormal AB + MO1-drll.3 Fig. 3 with image,  Fig. 4 with image from Pimtong et al., 2014
nucleate erythrocyte decreased amount, abnormal AB + MO1-drll.3 Fig. 3 with image,  Fig. 4 with image from Pimtong et al., 2014
primitive hemopoiesis process quality, abnormal sd2Tg + MO1-drll.3 Fig. 7 with image from Pimtong et al., 2014
whole organism gata1b expression decreased amount, abnormal AB + MO1-drll.3 Fig. 4 with image from Pimtong et al., 2014
whole organism Ab1-drl labeling decreased amount, abnormal AB + MO1-drll.3 Fig. 2 with image from Pimtong et al., 2014
whole organism spi1b expression decreased amount, abnormal AB + MO1-drll.3 Fig. 4 with image from Pimtong et al., 2014
whole organism drll.3 expression decreased amount, abnormal AB + MO1-drll.3 Fig. 2 with image,  Fig. 4 with image from Pimtong et al., 2014
Phenotype of all Fish created by or utilizing MO1-drll.3
Phenotype Fish Conditions Figures
common myeloid progenitor spi1b expression decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 4 with image from Pimtong et al., 2014
myeloid cell cell chemotaxis decreased occurrence, abnormal AB + MO1-drll.3 transection: caudal fin Fig. 4 with image from Pimtong et al., 2014
granulocyte mpx expression decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 4 with image from Pimtong et al., 2014
common myeloid progenitor decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 4 with image from Pimtong et al., 2014
erythroid lineage cell gata1a expression decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 3 with image,  Fig. 5 with image from Pimtong et al., 2014
whole organism spi1b expression decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 4 with image from Pimtong et al., 2014
whole organism drll.3 expression decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 2 with image,  Fig. 4 with image from Pimtong et al., 2014
erythrocyte differentiation decreased occurrence, abnormal AB + MO1-drll.3 standard conditions Fig. 3 with image from Pimtong et al., 2014
whole organism Ab1-drl labeling decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 2 with image from Pimtong et al., 2014
erythroid lineage cell slc4a1a expression decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 3 with image,  Fig. 4 with image,  Fig. 5 with image from Pimtong et al., 2014
regenerating fin myeloid cell decreased amount, abnormal AB + MO1-drll.3 transection: caudal fin Fig. 4 with image from Pimtong et al., 2014
myeloid cell decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 4 with image from Pimtong et al., 2014
granulocyte decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 4 with image from Pimtong et al., 2014
erythroid lineage cell decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 3 with image,  Fig. 4 with image from Pimtong et al., 2014
nucleate erythrocyte hbae1.1 expression decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 3 with image,  Fig. 4 with image from Pimtong et al., 2014
nucleate erythrocyte decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 3 with image,  Fig. 4 with image from Pimtong et al., 2014
myeloid cell lyz expression decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 4 with image from Pimtong et al., 2014
monocyte lcp1 expression decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 5 with image from Pimtong et al., 2014
whole organism gata1b expression decreased amount, abnormal AB + MO1-drll.3 standard conditions Fig. 4 with image from Pimtong et al., 2014
erythrocyte maturation decreased occurrence, abnormal sd2Tg + MO1-drll.3 standard conditions Fig. 7 with image from Pimtong et al., 2014
circulating cell nucleate erythrocyte decreased amount, abnormal sd2Tg + MO1-drll.3 standard conditions Fig. 3 with image from Pimtong et al., 2014
primitive hemopoiesis process quality, abnormal sd2Tg + MO1-drll.3 standard conditions Fig. 7 with image from Pimtong et al., 2014
blood island edematous, abnormal y1Tg + MO1-drll.3 standard conditions Fig. 3 with image from Pimtong et al., 2014
myeloid cell cell chemotaxis decreased occurrence, abnormal zdf11Tg + MO1-drll.3 transection: caudal fin Fig. 4 with image from Pimtong et al., 2014
regenerating fin myeloid cell decreased amount, abnormal zdf11Tg + MO1-drll.3 transection: caudal fin Fig. 4 with image from Pimtong et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.