header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-190719-1
Morpholino Name: MO1-sox1a,sox1b
Targets: sox1a (1), sox1b (1)
Sequence:
5' - CCGTTTCCATCATCATGCTATACAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO targets both sox1a and sox1b. There is a single nucleotide mismatch with sox1b.
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-sox1a,sox1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-sox1a,sox1b No data available
PHENOTYPE
Phenotype resulting from MO1-sox1a,sox1b
No data available

Phenotype of all Fish created by or utilizing MO1-sox1a,sox1b
No data available
Genome Resources:
CITATIONS (1)