ZFIN ID: ZDB-MRPHLNO-190314-1
Morpholino Name: MO3-drl,drll.2
Targets: drl (1), drll.2 (1)
Sequence:
5' - TCAAGAACAGACACCAACCTCTTTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-drl,drll.2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-drl,drll.2
Expressed Gene Anatomy Figures
drl Fig. 2 with image from Pimtong et al., 2014
drll.1 Fig. 2 with image from Pimtong et al., 2014
drll.2 Fig. 2 with image from Pimtong et al., 2014
PHENOTYPE
Phenotype resulting from MO3-drl,drll.2
No data available

Phenotype of all Fish created by or utilizing MO3-drl,drll.2
Genome Resources:
CITATIONS (1)