Morpholino

MO4-zgc:100846

ID

ZDB-MRPHLNO-180910-1

Name

MO4-zgc:100846

Previous Names

None

Target

Sequence

5' - TATAGACCGTCAGGCTCACAAAGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets the 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-zgc:100846

Expressed Gene	Anatomy	Figures
ccng1	whole organism	Fig. S5 from Yeh et al., 2018
tp53	whole organism	Fig. S5 from Yeh et al., 2018

Phenotype

Phenotype resulting from MO4-zgc:100846

Phenotype	Fish	Figures
hindbrain commissure disorganized, abnormal	TU + MO4-zgc:100846	Fig. 2 from Yeh et al., 2018
hindbrain commissure axon decreased amount, abnormal	TU + MO4-zgc:100846	Fig. 2 from Yeh et al., 2018
motor neuron axon decreased length, abnormal	TU + MO4-zgc:100846	Fig. 1 from Yeh et al., 2018
musculoskeletal movement decreased frequency, abnormal	TU + MO4-zgc:100846	Fig. 3, Fig. 5, Fig. 7 from Yeh et al., 2018
musculoskeletal movement decreased magnitude, abnormal	TU + MO4-zgc:100846	Fig. 3 from Yeh et al., 2018
thigmotaxis decreased process quality, abnormal	TU + MO4-zgc:100846	Fig. 1, Fig. 7 from Yeh et al., 2018
whole organism ccng1 expression increased amount, abnormal	TU + MO4-zgc:100846	Fig. S5 from Yeh et al., 2018
whole organism tp53 expression increased amount, abnormal	TU + MO4-zgc:100846	Fig. S5 from Yeh et al., 2018

Phenotype of all Fish created by or utilizing MO4-zgc:100846

Phenotype	Fish	Conditions	Figures
hindbrain commissure disorganized, abnormal	TU + MO4-zgc:100846	standard conditions	Fig. 2 from Yeh et al., 2018
whole organism ccng1 expression increased amount, abnormal	TU + MO4-zgc:100846	standard conditions	Fig. S5 from Yeh et al., 2018
whole organism tp53 expression increased amount, abnormal	TU + MO4-zgc:100846	standard conditions	Fig. S5 from Yeh et al., 2018
musculoskeletal movement decreased magnitude, abnormal	TU + MO4-zgc:100846	standard conditions	Fig. 3 from Yeh et al., 2018
motor neuron axon decreased length, abnormal	TU + MO4-zgc:100846	standard conditions	Fig. 1 from Yeh et al., 2018
thigmotaxis decreased process quality, abnormal	TU + MO4-zgc:100846	standard conditions	Fig. 1, Fig. 7 from Yeh et al., 2018
hindbrain commissure axon decreased amount, abnormal	TU + MO4-zgc:100846	standard conditions	Fig. 2 from Yeh et al., 2018
musculoskeletal movement decreased frequency, abnormal	TU + MO4-zgc:100846	standard conditions	Fig. 3, Fig. 5, Fig. 7 from Yeh et al., 2018

Citations