Morpholino

MO1-mpc1

ID
ZDB-MRPHLNO-180130-8
Name
MO1-mpc1
Previous Names
None
Target
Sequence
5' - TCAGAGCTGTGGACACACCAGAGGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mpc1
Expressed Gene Anatomy Figures
ascl1a Fig. 2 with image from Sandoval et al., 2017
cs Fig. 4 S1 from Sandoval et al., 2017
fabp2 Fig. 2 with image from Sandoval et al., 2017
gata6 Fig. 2 with image from Sandoval et al., 2017
id1 Fig. 2 with image from Sandoval et al., 2017
ins Fig. 2 with image from Sandoval et al., 2017
ldha Fig. 4 S1 from Sandoval et al., 2017
mpc2b Fig. 4 S1 from Sandoval et al., 2017
myl7 Fig. 2 with image from Sandoval et al., 2017
pcxb Fig. 4 S1 from Sandoval et al., 2017
pdha1a Fig. 4 S1 from Sandoval et al., 2017
pdk1 Fig. 4 S1 from Sandoval et al., 2017
pkma Fig. 4 S1 from Sandoval et al., 2017
prss1 Fig. 2 with image from Sandoval et al., 2017
rbp3 Fig. 2 with image from Sandoval et al., 2017
slc16a1b Fig. 4 S1 from Sandoval et al., 2017
slc16a3b Fig. 4 S1 from Sandoval et al., 2017
Phenotype
Phenotype resulting from MO1-mpc1
Phenotype Fish Figures
aerobic respiration decreased rate, abnormal TU + MO1-mpc1 Fig. 4 with image from Sandoval et al., 2017
brain ascl1a expression decreased amount, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
digestive tract development process quality, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
exocrine pancreas prss1 expression decreased amount, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
exocrine pancreas development decreased occurrence, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
eye decreased size, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
gut fabp2 expression decreased amount, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
gut has fewer parts of type cell, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
head decreased size, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
heart looping decreased occurrence, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
hindbrain increased size, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
intestine shape, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
intestine surface feature shape, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
lens decreased size, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
mandibular arch skeleton cartilage development decreased occurrence, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
pectoral fin absent, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
pectoral fin bud id1 expression decreased amount, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
pericardium edematous, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
retinal neural layer malformed, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
retinal photoreceptor layer rbp3 expression decreased amount, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
retinal pigmented epithelium rbp3 expression decreased amount, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
whole organism curved, abnormal TU + MO1-mpc1 Fig. 2 with image from Sandoval et al., 2017
whole organism mpc2b expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism slc16a1b expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism pdha1a expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism pdk1 expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism cs expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism pkma expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism ldha expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism pcxb expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism slc16a3b expression increased amount, abnormal TU + MO1-mpc1 Fig. 4 S1 from Sandoval et al., 2017
whole organism triglyceride decreased amount, abnormal TU + MO1-mpc1 Fig. 4 with image from Sandoval et al., 2017
Phenotype of all Fish created by or utilizing MO1-mpc1
Phenotype Fish Conditions Figures
whole organism slc16a1b expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
whole organism pcxb expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
retinal pigmented epithelium rbp3 expression decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism cs expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
exocrine pancreas development decreased occurrence, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
pectoral fin bud id1 expression decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
exocrine pancreas prss1 expression decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
aerobic respiration decreased rate, abnormal TU + MO1-mpc1 standard conditions Fig. 4 with image from Sandoval et al., 2017
intestine surface feature shape, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism mpc2b expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
gut has fewer parts of type cell, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
mandibular arch skeleton cartilage development decreased occurrence, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
retinal photoreceptor layer rbp3 expression decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
pectoral fin absent, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
retinal neural layer malformed, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
lens decreased size, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
brain ascl1a expression decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
digestive tract development process quality, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism pdk1 expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
heart looping decreased occurrence, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism curved, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
eye decreased size, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
gut fabp2 expression decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism triglyceride decreased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 with image from Sandoval et al., 2017
head decreased size, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism pdha1a expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
whole organism pkma expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
hindbrain increased size, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
pericardium edematous, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism ldha expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
intestine shape, abnormal TU + MO1-mpc1 standard conditions Fig. 2 with image from Sandoval et al., 2017
whole organism slc16a3b expression increased amount, abnormal TU + MO1-mpc1 standard conditions Fig. 4 S1 from Sandoval et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.