Morpholino

MO1-qki2

ID

ZDB-MRPHLNO-171116-2

Name

MO1-qki2

Previous Names

5’UTR (1)

Target

qki2 (1)

Sequence

5' - GGGTTTTAATGTGTTTCCCCGTATT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-qki2

Expressed Gene	Anatomy	Figures
tpm3	whole organism	Fig. 4 from Bonnet et al., 2017

Phenotype

Phenotype resulting from MO1-qki2

No data available

Phenotype of all Fish created by or utilizing MO1-qki2

Phenotype	Fish	Conditions	Figures
whole organism tpm3 expression decreased amount, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 4 from Bonnet et al., 2017
slow muscle cell myosin complex aggregated, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 1 from Bonnet et al., 2017
slow muscle cell somite 14 ab-f59 labeling spatial pattern, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 3 from Bonnet et al., 2017
slow muscle cell skeletal muscle myosin thick filament assembly decreased process quality, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 3 from Bonnet et al., 2017
slow muscle cell striated muscle myosin thick filament decreased length, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 3 from Bonnet et al., 2017
slow muscle cell somite 8 ab-f59 labeling spatial pattern, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 3 from Bonnet et al., 2017
slow muscle cell skeletal muscle myofibril decreased length, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 1 from Bonnet et al., 2017
slow muscle cell skeletal muscle myofibril decreased thickness, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 1 from Bonnet et al., 2017
slow muscle cell striated muscle thin filament decreased length, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 3 from Bonnet et al., 2017
slow muscle cell skeletal muscle cell differentiation decreased process quality, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 4 from Bonnet et al., 2017
slow muscle cell ab1-actn labeling spatial pattern, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 3 from Bonnet et al., 2017
slow muscle cell ab-f59 labeling spatial pattern, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 3 from Bonnet et al., 2017
slow muscle cell skeletal myofibril assembly decreased process quality, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 1 from Bonnet et al., 2017
slow muscle cell skeletal muscle myofibril malformed, abnormal	qkia^{t31954/t31954} + MO1-qki2	standard conditions	Fig. 1 from Bonnet et al., 2017

Citations