header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-170915-3
Morpholino Name: MO6-lbx2
Target: lbx2 (1)
Previous Name: MO-SA (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TGTGTTCACGACCTTAAAATGGAAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO6-lbx2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO6-lbx2 No data available
PHENOTYPE
Phenotype resulting from MO6-lbx2
No data available

Phenotype of all Fish created by or utilizing MO6-lbx2
Phenotype Fish Conditions Figures
margin ventral region eve1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased amount, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased distribution, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin posterior region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism wholly dorsalized, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
axial mesoderm chrd expression increased distribution, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1Fig. 5 from Lu et al., 2014
trunk ventral region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
presumptive ectoderm foxi1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
whole organism elongated, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
canonical Wnt signaling pathway decreased occurrence, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 control Fig. 2 from Lu et al., 2014
margin ventral region eve1 expression decreased amount, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
caudal fin ventral region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
trunk posterior region absent, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1 from Lu et al., 2014
ventral mesoderm chrd expression mislocalised, abnormal AB/TU + MO4-tp53 + MO6-lbx2 + MO7-lbx2 standard conditions Fig. 1Fig. 5 from Lu et al., 2014
OTHER MO6-lbx2 MORPHOLINO PAGESNo links to external sites
CITATIONS (1)