ZFIN ID: ZDB-MRPHLNO-170719-1
Morpholino Name: MO1-dgat2
Target: dgat2 (1)
Previous Name: dgat2_e2 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CCGAGCCTACACAGGATTTAAAGGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dgat2 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dgat2
Expressed Gene Anatomy Figures
ddit3 Fig. 5 from O'Hare et al., 2017
edem1 Fig. 5 from O'Hare et al., 2017
hspa5 Fig. 5 from O'Hare et al., 2017
xbp1 Fig. 5 from O'Hare et al., 2017
PHENOTYPE
Phenotype resulting from MO1-dgat2
Phenotype of all Fish created by or utilizing MO1-dgat2
Genome Resources:
CITATIONS (1)