Morpholino

MO1-hsd17b4

ID
ZDB-MRPHLNO-160907-3
Name
MO1-hsd17b4
Previous Names
None
Target
Sequence
5' - TCGGTGATGAAGAACTGACCTCCGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hsd17b4
Expressed Gene Anatomy Figures
agps Fig. 5 from Kim et al., 2014
esrra Fig. 5 from Kim et al., 2014
gnpat2 Fig. 5 from Kim et al., 2014
pex5 Fig. 5 from Kim et al., 2014
pparab Fig. 5 from Kim et al., 2014
ppargc1a Fig. 5 from Kim et al., 2014
Phenotype
Phenotype resulting from MO1-hsd17b4
Phenotype Fish Figures
branching involved in blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-hsd17b4 Fig. 4 with image from Kim et al., 2014
embryo development disrupted, abnormal WT + MO1-hsd17b4 Fig. 2 with image from Kim et al., 2014
head decreased size, abnormal WT + MO1-hsd17b4 Fig. 2 with image from Kim et al., 2014
lipid homeostasis disrupted, abnormal WT + MO1-hsd17b4 Fig. 3 with image from Kim et al., 2014
liver decreased size, abnormal gz15Tg + MO1-hsd17b4 Fig. 4 with image from Kim et al., 2014
motor neuron axon development disrupted, abnormal ck1Tg + MO1-hsd17b4 Fig. 3 with image from Kim et al., 2014
motor neuron axonogenesis disrupted, abnormal ck1Tg + MO1-hsd17b4 Fig. 3 with image from Kim et al., 2014
nucleate erythrocyte decreased amount, abnormal ko05Tg + MO1-hsd17b4 Fig. 4 with image from Kim et al., 2014
pancreas absent, abnormal gz15Tg + MO1-hsd17b4 Fig. 4 with image from Kim et al., 2014
pericardium edematous, abnormal WT + MO1-hsd17b4 Fig. 2 with image from Kim et al., 2014
terminal Schwann cell EGFP expression decreased amount, abnormal ck1Tg + MO1-hsd17b4 Fig. 3 with image from Kim et al., 2014
trunk curved, abnormal WT + MO1-hsd17b4 Fig. 2 with image from Kim et al., 2014
whole organism ppargc1a expression decreased amount, abnormal WT + MO1-hsd17b4 Fig. 5 from Kim et al., 2014
whole organism esrra expression decreased amount, abnormal WT + MO1-hsd17b4 Fig. 5 from Kim et al., 2014
whole organism pparab expression decreased amount, abnormal WT + MO1-hsd17b4 Fig. 5 from Kim et al., 2014
whole organism pex5 expression decreased amount, abnormal WT + MO1-hsd17b4 Fig. 5 from Kim et al., 2014
whole organism gnpat2 expression decreased amount, abnormal WT + MO1-hsd17b4 Fig. 5 from Kim et al., 2014
whole organism agps expression decreased amount, abnormal WT + MO1-hsd17b4 Fig. 5 from Kim et al., 2014
yolk increased size, abnormal WT + MO1-hsd17b4 Fig. 2 with image,  Fig. 3 with image from Kim et al., 2014
Phenotype of all Fish created by or utilizing MO1-hsd17b4
Phenotype Fish Conditions Figures
whole organism pparab expression decreased amount, abnormal WT + MO1-hsd17b4 standard conditions Fig. 5 from Kim et al., 2014
trunk curved, abnormal WT + MO1-hsd17b4 standard conditions Fig. 2 with image from Kim et al., 2014
whole organism agps expression decreased amount, abnormal WT + MO1-hsd17b4 standard conditions Fig. 5 from Kim et al., 2014
embryo development disrupted, abnormal WT + MO1-hsd17b4 standard conditions Fig. 2 with image from Kim et al., 2014
whole organism pex5 expression decreased amount, abnormal WT + MO1-hsd17b4 standard conditions Fig. 5 from Kim et al., 2014
head decreased size, abnormal WT + MO1-hsd17b4 standard conditions Fig. 2 with image from Kim et al., 2014
whole organism ppargc1a expression decreased amount, abnormal WT + MO1-hsd17b4 standard conditions Fig. 5 from Kim et al., 2014
lipid homeostasis disrupted, abnormal WT + MO1-hsd17b4 standard conditions Fig. 3 with image from Kim et al., 2014
yolk increased size, abnormal WT + MO1-hsd17b4 standard conditions Fig. 2 with image,  Fig. 3 with image from Kim et al., 2014
pericardium edematous, abnormal WT + MO1-hsd17b4 standard conditions Fig. 2 with image from Kim et al., 2014
whole organism esrra expression decreased amount, abnormal WT + MO1-hsd17b4 standard conditions Fig. 5 from Kim et al., 2014
whole organism gnpat2 expression decreased amount, abnormal WT + MO1-hsd17b4 standard conditions Fig. 5 from Kim et al., 2014
motor neuron axonogenesis disrupted, abnormal ck1Tg + MO1-hsd17b4 standard conditions Fig. 3 with image from Kim et al., 2014
motor neuron axon development disrupted, abnormal ck1Tg + MO1-hsd17b4 standard conditions Fig. 3 with image from Kim et al., 2014
terminal Schwann cell EGFP expression decreased amount, abnormal ck1Tg + MO1-hsd17b4 standard conditions Fig. 3 with image from Kim et al., 2014
pancreas absent, abnormal gz15Tg + MO1-hsd17b4 standard conditions Fig. 4 with image from Kim et al., 2014
liver decreased size, abnormal gz15Tg + MO1-hsd17b4 standard conditions Fig. 4 with image from Kim et al., 2014
nucleate erythrocyte decreased amount, abnormal ko05Tg + MO1-hsd17b4 standard conditions Fig. 4 with image from Kim et al., 2014
branching involved in blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-hsd17b4 standard conditions Fig. 4 with image from Kim et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.