Morpholino

MO2-tnksb

ID
ZDB-MRPHLNO-160216-2
Name
MO2-tnksb
Previous Names
  • TNKS1b-SB (1)
Target
Sequence
5' - GGTGAAAGTGACTTACAGGTGAGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tnksb
Expressed Gene Anatomy Figures
agrp Fig. 5 from Wang et al., 2015
gh1 Fig. 5 from Wang et al., 2015
ins Fig. 3 from Wang et al., 2015
mc3r Fig. 7 from Wang et al., 2015
mc4r Fig. 7 from Wang et al., 2015
mc5ra Fig. 7 from Wang et al., 2015
mc5rb Fig. 7 from Wang et al., 2015
pck1 Fig. 3 from Wang et al., 2015
pomca Fig. 5 from Wang et al., 2015
pou1f1 Fig. 5 from Wang et al., 2015
prl Fig. 5 from Wang et al., 2015
tshba Fig. 5 from Wang et al., 2015
Phenotype
Phenotype resulting from MO2-tnksb
Phenotype Fish Figures
glucose homeostasis process quality, abnormal WT + MO2-tnksb Fig. 3 from Wang et al., 2015
pars intermedia melanocyte stimulating hormone secreting cell ab2-amsh labeling decreased amount, abnormal WT + MO2-tnksb Fig. 5 from Wang et al., 2015
pars intermedia melanocyte stimulating hormone secreting cell pomca expression decreased amount, abnormal WT + MO2-tnksb Fig. 5 from Wang et al., 2015
whole organism pomca expression decreased amount, abnormal WT + MO2-tnksb Fig. 5 from Wang et al., 2015
whole organism pck1 expression decreased amount, abnormal WT + MO2-tnksb Fig. 3 from Wang et al., 2015
whole organism decreased length, abnormal WT + MO2-tnksb Fig. 2 from Wang et al., 2015
whole organism mc4r expression increased amount, abnormal WT + MO2-tnksb Fig. 7 from Wang et al., 2015
whole organism ins expression increased amount, abnormal WT + MO2-tnksb Fig. 3 from Wang et al., 2015
whole organism ab1-slc2a4 labeling increased amount, abnormal WT + MO2-tnksb Fig. 3 from Wang et al., 2015
Phenotype of all Fish created by or utilizing MO2-tnksb
Phenotype Fish Conditions Figures
whole organism mc4r expression increased amount, abnormal WT + MO2-tnksb standard conditions Fig. 7 from Wang et al., 2015
whole organism pck1 expression decreased amount, abnormal WT + MO2-tnksb standard conditions Fig. 3 from Wang et al., 2015
whole organism pomca expression decreased amount, abnormal WT + MO2-tnksb standard conditions Fig. 5 from Wang et al., 2015
whole organism ab1-slc2a4 labeling increased amount, abnormal WT + MO2-tnksb standard conditions Fig. 3 from Wang et al., 2015
glucose homeostasis process quality, abnormal WT + MO2-tnksb standard conditions Fig. 3 from Wang et al., 2015
pars intermedia melanocyte stimulating hormone secreting cell ab2-amsh labeling decreased amount, abnormal WT + MO2-tnksb control Fig. 5 from Wang et al., 2015
pars intermedia melanocyte stimulating hormone secreting cell pomca expression decreased amount, abnormal WT + MO2-tnksb standard conditions Fig. 5 from Wang et al., 2015
whole organism ins expression increased amount, abnormal WT + MO2-tnksb standard conditions Fig. 3 from Wang et al., 2015
whole organism decreased length, abnormal WT + MO2-tnksb standard conditions Fig. 2 from Wang et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.