header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160216-2
Morpholino Name: MO2-tnksb
Target: tnksb (1)
Previous Name: TNKS1b-SB (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGTGAAAGTGACTTACAGGTGAGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: splice-blocker
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-tnksb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-tnksb
Expressed Gene Anatomy Figures
agrp Fig. 5 from Wang et al., 2015
gh1 Fig. 5 from Wang et al., 2015
ins Fig. 3 from Wang et al., 2015
mc3r Fig. 7 from Wang et al., 2015
mc4r Fig. 7 from Wang et al., 2015
mc5ra Fig. 7 from Wang et al., 2015
mc5rb Fig. 7 from Wang et al., 2015
pck1 Fig. 3 from Wang et al., 2015
pomca Fig. 5 from Wang et al., 2015
pou1f1 Fig. 5 from Wang et al., 2015
prl Fig. 5 from Wang et al., 2015
tshba Fig. 5 from Wang et al., 2015
PHENOTYPE
Phenotype resulting from MO2-tnksb
Phenotype of all Fish created by or utilizing MO2-tnksb
Genome Resources:
CITATIONS (1)