ZFIN ID: ZDB-MRPHLNO-160126-5
Morpholino Name: MO3-junbb
Target: junbb (1)
Sequence:
5' - GCTGCTCCATTTTTGTACTCATAGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-junbb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-junbb No data available
PHENOTYPE
Phenotype resulting from MO3-junbb
Phenotype of all Fish created by or utilizing MO3-junbb
Genome Resources:
CITATIONS (1)